Postparser v2.3 // project Bladder

Databases: ABC1_contigs // chromosome: chr13

Shown 1-30 from 85 sequences on 1 of 3 pages.
Pages:  1  2  3

>6285 114 154    13q11    chr13:19114776-19114889 BLAT!
AATTATGACAAGGAGTTTACACAGGTCAGCCTATAAAACTACTGCATAATTTCTATCTGT
AAATTAAAATAGAAAAGAAATAAGATTGAAGTAAATATGATAATAGTAAATTTC


invisible?    
Gene introns: 0   Nearest EST: 0

>18619 224 1798    13q12.11    chr13:19879028-19879251 BLAT!
TGCCAATATCACCAGTTGCAACAGCTCCAGGTCTCCTGTGGGTTTTCGTTTGACCATGCG
TAGCAGGCTGGCCTTTAAATCCCCATCTTTTCATGACACCTTGAAAACCTTTACCAATAG
TTTTGGCTGTGACATCCACATACTGTCCTGGACGAAAGTGAGCAGCATAAAGAGGAGTGC
CTGGTTTAATTGCAGCATTATCTGTTATATTAAAGATTTTAACT


invisible?    
Gene introns: LOC100101938 (19836939 - 19919113)   Nearest EST:

>13236 186 559    13q12.11    chr13:22346558-22346373 BLAT!
AAATGGTGATGATTCAATGAGGTGTTTGCAGATTGCTTTACACTTAGTGTTATATAAATG
TTTGCTTATAAAGTTAATAAAAATGAATAAGCCATGCTACTATCTAACGAAATTTTTCTA
ACTAGGCAAATTAAATTCCTCTAACTTCATTTCATTTCTCCTGTTCATTATTCAATGGAC
CTATTT


invisible?    
Gene introns: 0   Nearest EST: 0

>4533 112 221    13q12.11    chr13:22346640-22346751 BLAT!
ATTGGAGTCTGTTTGACTTGAGAGCCTGGAATCGCCTCACACCATCTTGCCTGCCTCGCT
CTCTGTCTCTGTGCAATCTTTGATGGATTCGGTTTTTTGCCTGGAACACCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>1891 647 34338 11745+,26772-,50492-    13q12.11    chr13:23270671-23270062 BLAT!
AGCGGCCGCCCGGGCAGGTACGCGGGGGCAGGACTCAGAGGCCGCCATCAACCGCCAGAT
CAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGA
TGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGA
ACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGA
TATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATT
ACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAA
AAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGC
CATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGG
CTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAAGC
CTCGGGCTAATTTCCCCATAGCCGTGGGGTGACTTCCCTGGTCACCAAGGCAGTGCATGC
ATGTTGGGGTTTCCTTTACCTTTTCTATAAGTTGTACCTCGGCCGCG


invisible?    
Gene introns: 0   Nearest EST: AA973932 (23269985 - 23270150)

>3982 144 255    13q12.12    chr13:23430096-23429953 BLAT!
GTGTTCATAAGTGGTTGTAAATCCTTCTCTTGCATCATACTTGCTAAGCACCCACTGGCC
AAATCTAATCACATGGCCAAGACCAGAGTCAATGTGGGTAGGGATACACATGGCAAAATA
CCAGGAGGCATGCTTCATTAAGGA


invisible?    
Gene introns: 0   Nearest EST: 0

>18904 235 694    13q12.3    chr13:30502647-30502832 BLAT!
GAAGTTTCTGGGGAAACTGGATTTTATCCCTATATTTCTTTATGTATTCAGTTTAGTCTA
TCAAAAAGGAGCCCTGCAAATAAATTTTCTTCATAAAAAAAGCTGATTAGAAAAGGCCAT
TTTAGGCCAGGCGCAGTGGCTCACACCTGTAATCCCTGCACTTTGGAAGGCTGAGGTGGA
TGGATCGCTTGAGGCAAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACTCT


invisible?    
Gene introns: 0   Nearest EST: 0

>23300 111 0    13q12.3    chr13:30502647-30502685 BLAT!
CGCGGGGCTATATCTCCTGTAGTAATAACACAGGGGTTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAAGTTTCTGGGGAAACTGGATTTTATCCCTATATTTCT


invisible?    
Gene introns: 0   Nearest EST: 0

>13992 174 340    13q13.1    chr13:32359263-32359436 BLAT!
CAGGCTCCCTCCCAGAAAGTCTGATGTGATAGTTCCAAGGTGGGTCCCGGGGATGTGCTC
TTTTTATAAGCATCCTTGGGGACTTGGATGCTTGGACTCTACTATGAAAACTACTGCCTT
GAAGTGCACGCATGGCTTTCCTATTTTGTCTCCACGCACTCTCCATGACGTCCT


invisible?    
Gene introns: RXFP2 (32313678 - 32377009)   Nearest EST:

>19684 116 206    13q13.1    chr13:32709168-32709283 BLAT!
ATCACAAAATCAACAATTTTATTAATATAATATTCACATGCATCTCTATTTCAGGCTGTT
AAAAATGAAGTAAATGTTCCCTGCCTTAGAAATTTTGTGGAAAGCCTGTATGACAC


invisible?    
Gene introns: FRY (32605436 - 32870776)   Nearest EST:

>20614 113 164    13q13.1    chr13:32757184-32757114 BLAT!
TTCAAATTCTTACCTCTGGTCTTCTTTCCAGAGCTTCTTTCATTAATGGATGAAGTTCTT
CTACCAATTCTCTGAAAACAAGGGAATTTGTTCTTCCAAATCCTAAAACTAAG


invisible?    
Gene introns: FRY (32605436 - 32870776)   Nearest EST:

>6901 170 938    13q13.1    chr13:32768128-32768297 BLAT!
CTCTTGAAGAATATATGACATAAAAACCAAAATGAAAGCTCGGTCTTCCCTTTCATTTTA
CTCAGTTTATATTGACTAAGCTTTATCTGTATCTTTCTCTAGAACATTCTTTCATCAAAT
GGGAATAATATTGATTTGCTCCATGTATTCAGGTTCATCAACTTGGCTGC


invisible?    
Gene introns: FRY (32605436 - 32870776)   Nearest EST:

>17816 196 1296    13q13.3    chr13:37760671-37760476 BLAT!
TCTCTCATTACCACGTGACATTGTCCCCAGATAACTCTACCTAAATAATACCTTTCCAAT
CTATTCCCTCCTCTATATTTCCTCCTCAAGCCCTACCTCAGGCCCTCAACCTCTCTTACT
GAGACCTGTGAAATAGTCTTCTAACTGGTCTCCCTGTCCTAACCTTTCCTCTTTCTAATC
CATTCTGCATAATATT


invisible?    
Gene introns: 0   Nearest EST: 0

>15627 123 530    13q13.3    chr13:37760942-37761064 BLAT!
CCAGGCCACACAGAAGGATTGTAACAGTGTATGAGTGACAGTCTGGAGTCCTTGGCACAT
ATATTTCTACTTTACTTTGTCATGGGCGACCTTGCTATTGACCCCCATTTGTTACATTCT
TCT


invisible?    
Gene introns: 0   Nearest EST: 0

>17828 169 369    13q13.3    chr13:38997533-38997365 BLAT!
TCTTTGATATGGCAAATTATGTGGAAAACATTGTCAAATAAGAAATGATGTTTAACCTTT
TTCGAGTTATATTTTAATTAATGTTATTAATATCTGTTCCAAAATTGTATAGAATTCCTA
AAATTCTCAAATGTTTGGATCTATGCTATCATTCATATTTTTTGCTGTT


invisible?    
Gene introns: 0   Nearest EST: 0

>5818 157 469    13q14.11    chr13:44638189-44638345 BLAT!
GATGATGATGCATTTACTGAGATCAGGAAGATAAAAAACAGACTGCGGTGAGGAAATCAA
AAGTCTGCAACATATCAGGTTTGTTATGCTTATGAGACACTGCAGTGAAGCACTGAGTAG
GCATTTGCATATACTCACTCGTTAACATATATTTTTG


invisible?    
Gene introns: 0   Nearest EST: 0

>2114 517 23353 33843+,16280+    13q14.2    chr13:49345325-49345717 BLAT!
AGGTCTTCAGTTTCCTCATTTGCAAGTCTTGGACCCAGTGATTTCCAAAGGCCCTTCCAG
TTCCATTTGTCAGACATCTCATTGAGCATATTCTGTGATTCCCCTCCCTTGCAATGTAAC
CCACAGGCTGAGGAATTCCTCTACAGATTCTTGCCACAGAAAATCATATACCTGAATCAG
CTCTTGCAAGAGGACTCCCTCAATGTGGCTGACTTGACTTCCCTCCGGGCCCCACTGGAC
ATCCCCATCCCAGACCCTCCACCCAAGGATGATGAGATGGAAACAGATAAGCAGGAGAAG
AAAGAAGTCCCTAAGTGTGGATTTCTCCCTGGGAATGAGAAAGTCCTGTCCCTGCTTGCC
CTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAATGCATTCTGGTGATTACATGGATC
CAACACCTGATCCCCAAGATTGAAGATGGAAATGATTTTGGGGTAGCAATCCAGGAGAAG
GTGCTGGAGAGGGTGAATGCCGTCAAGACCAAAGTGG


invisible?    
Gene introns: 0   Nearest EST: AA454818 (49345626 - 49345690)

>313 110 7046    13q14.2    chr13:49345749-49345858 BLAT!
CTCAGAACGTGGGGATGCTGTGGCCAAGGCCTCCAAGGAGACTCATGTAATGGATTACCG
GGCCTTGGTGCATGAGCGAGATGAGGCAGCCTATGGGGAGCTCAGGGCCA


invisible?    
Gene introns: 0   Nearest EST: BF919983 (49345798 - 49345876)

>16978 113 321    13q14.2    chr13:49345768-49345880 BLAT!
GTGGCCAAGGCCTCCAAGGAGACTCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGA
GATGAGGCAGCCTATGGGGAGCTCAGGGCCATGGTGCTGGACCTGAGGGCCTT


invisible?    
Gene introns: 0   Nearest EST: BF919983 (49345798 - 49345876)

>3289 217 845    13q14.2    chr13:49785602-49785812 BLAT!
CAAACTCTTCTTGAATTTGAACTTGGTAATCCATGTCCAGATAAGTAGGGTTGATCCAAT
CATACAAAATCTCATGATCTTGTGGGATGTGAGGGCTCCGAGGTATGGGGGGTTCAAAGT
AGTTGGGAGGCCGAGTCAATGATGGACCATGAAACCAGCCACTTATAGACAAACGTGACT
TTTCTTCAGACAGCACTTCAGACACCTGGTGAAAGGA


invisible?    
Gene introns: 0   Nearest EST: 0

>14291 120 212    13q14.2    chr13:50552508-50552389 BLAT!
AGGGCCTCTAAAACCGATGGAAGTGAAGTGCTACACCTCAGAGCTGCTTTAGCCCTTAGA
GCTGGCCAGGGTCTGAGTGGGCCTCTCACAGGGCCACAGGACTGCCCTTTCCCCCAGCAT


invisible?    
Gene introns: 0   Nearest EST: 0

>5606 106 214    13q14.2    chr13:50552773-50552878 BLAT!
GAAGGGCAGGGCCTGAGCACTTTCCTGGCCTCTCAAATTTGAAGATGCCTGGGGGTCACT
GGGGAATCTTGTTGAAATGCAGAATCTGATCCAATAAGTCTAGAAT


invisible?    
Gene introns: 0   Nearest EST: 0

>11478 110 209    13q14.3    chr13:53826567-53826458 BLAT!
ACCAAAGCATTTTCTGAGCCTTTTTTTCACTTCTTTGATCACAGATCCTCTTTGTGGGAA
AGCAAGTCCAAATACCATAAAGGAAGGATATGCAGTAACATAATATAAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>5691 152 488    13q21.1    chr13:55756881-55757032 BLAT!
CTATAGTATTTTCAGAAGTTAGTAGAAACATAGGACATATTTCTAATAGAGTCTCCAGTA
AACTAGCTTTTAAAAGGTGTGCTTTACATAAGAGAAAAATAGTTGTCAGTGGAAATCTAA
AGGTAAAAATTTAATATTAAGTGAAGACATTA


invisible?    
Gene introns: 0   Nearest EST: 0

>2136 222 830 35397+,80231+,65830-    13q21.1    chr13:55756885-55757022 BLAT!
AGTATTTTCAGAAGTTAGTAGAAACATAGGACATATTTCTAATAGAGTCTCCAGTAAACT
AGCTTTTAAAAGGTGTGCTTTACATAAGAGAAAAATAGTTGTCAGTGGAAATCTAAAGGT
AAAAATTTAATATTAAGnCATGAGTTGGAAAATAGTTTATTGGAGTTTAAATGTTCTAAC
ATCTGTGTACCTCGGCCGCGACCACGCTGCCCTATAGTGAGT


invisible?    
Gene introns: 0   Nearest EST: 0

>6547 109 201    13q21.1    chr13:55766286-55766394 BLAT!
TTTTTAACATGGAGAATACATATAGCTTTAAAAGTCATATTCATTAATTATAATAAAATA
TGCTTAATGACTTCTTTGCATATTTATCTGTGGTTTTATACGATATCTG


invisible?    
Gene introns: 0   Nearest EST: 0

>9059 133 263    13q21.1    chr13:55821291-55821159 BLAT!
TTAAGGTCCTCTATGCCTTTTAATTGAATAATTTATCCCATTTACAATCAAGATTAATAT
TAATAGGTAAGGACTTACTAATGACATTTTGCTGTTTGTTTTCTGGTTGTTTTGTAACTC
CTTCTTTCTGTGT


invisible?    
Gene introns: 0   Nearest EST: 0

>18965 142 298    13q21.1    chr13:57899891-57899750 BLAT!
AACAGAATAAGAAAGTTTAGAACTTATCCCATTAAAACATTAAAATTTTTTGAAGCACCA
TGTTTGTTAAAAAGTGAACTTCAGAGATAGACAAAGAAAACAGCAGCAATAAGTGTGCCC
GTAACTACTGTGTTCATATACT


invisible?    
Gene introns: 0   Nearest EST: 0

>9822 166 378    13q21.1    chr13:57900071-57900236 BLAT!
CTTTCATATCATTAACAACATGCTCATATTTTACTTTTAATATTTTTCCTCTTTTCTGCC
TTATTTACTTAATTATCTAACTTAAAAATTTGCTAATCATTTGTTGTAGGGATTTAAGAC
TCTAAGCTGTTTATAGGTAGAAGGATAGGAGAGGTGAGAATTATAA


invisible?    
Gene introns: 0   Nearest EST: 0

>12139 176 531    13q21.2    chr13:60101433-60101608 BLAT!
ATTAAAAGGTATTGGAATGAGTCTTAAGTTACCTTCTGATAACCTCTAAATTTCTCTCTT
GTCTAAATCTAGGGCAATGTGTTCTTGCAGTCCTATAAGAAATAACTCTGACTCAAAGGC
CATATTTGGCTAGCAGAGAAGGTTGTTGTAGAGAGCTTCTGTCCTAGGATTGGAGC


invisible?    
Gene introns: 0   Nearest EST: 0

Shown 1-30 from 85 sequences on 1 of 3 pages.
Pages:  1  2  3

Databases: ABC1_contigs // chromosome: chr13