Postparser v2.3 // project Bladder

Databases: ABC1_contigs // chromosome: chr21

>16934 154 303    21p11.2    chr21:10368669-10368822 BLAT!
TGTATTGATTAAGTTGCTAGCTCTTAAAGGTATGGTTTGTGGTTTCTCCCCATATTACAG
TAGCAATATCAAAGATCACTGAATACAGATCACCATAATAGATATAATAATAGTGAAAAA
GCTTGCAATATTGTGAGAATCACCAAAATGTGAC


invisible?    
Gene introns: 0   Nearest EST: 0

>20520 105 302    21p11.2    chr21:10819555-10819632 BLAT!
CAACGCGAGTGCAGGGGAATGGAATGGAATGGAATGCAACGGAATGGAATCTTCCGGAAT
GGAATTGAATGGAATGGAATGGAATGAAATGCAATGGATTCAACT


invisible?    
Gene introns: 0   Nearest EST: 0

>20795 126 404    21p11.2    chr21:10822444-10822383 BLAT!
ATTCCGTTCTGTTCCGTTCCATTCCATTCCATTCCATTCCATTCCATGCCGTTCCGTTCC
ATTCCATTCCATTCCACTCCATTCTACTCTGGTTAATTCCATTCCATTCCATTCGATTGC
AATCGA


invisible?    
Gene introns: 0   Nearest EST: 0

>15603 156 845    21p11.2    chr21:10822471-10822410 BLAT!
TCCACCCCATTCCATTCCCTCCACCCCATTCCATTCTACTTCTTTCCATTCCTCTCCAGT
CCATTCCACTCCAATCCACTTCATTCCATTTCACTCCACTCCATTCCATTCCGTTACATT
GCAATCCATTCCATGCCATTCCACTCCATTCCATTC


invisible?    
Gene introns: 0   Nearest EST: 0

>1014 136 903    21p11.2    chr21:10848998-10849091 BLAT!
AATGGAATGGAATGGAATGGAATGGAATGGAATGGAATTGTTCCGAATGGAATAGGAGGG
AATGTATACGAGTGGAATGGAAAGGAATGGAATCAATCAGAGTGGAATGGAAGGGAATGG
AATGGAATGGAAACTA


invisible?    
Gene introns: 0   Nearest EST: 0

>13892 163 426    21p11.1    chr21:11112377-11112539 BLAT!
AGCTGAGGTCGCACCACTGCACTCCAGCCTGCTGGACGACAGAGCAAGACTCTGTCTCAA
GAAACAAAACAAAACAAAAACAAAAACTTAAACACCAGGGAACACACACAACACACATAC
CAATAAGATCATGAAGAAGGAACGGCTGAAAAGTCCACCAATT


invisible?    
Gene introns: 0   Nearest EST: 0

>11509 151 395    21p11.1    chr21:11186745-11186600 BLAT!
CTAATTTTTTGGATTTTTAGTAGTGACAGCCTTTCACTGTATTGGCCAGGATGGTCTTGA
TCTCCTCACCTTGTGATCCCCTTGCCTTGGCCTCCAAATTTGCTGGGATTACAGGCCTGA
GCCAAGATCCATATTTTTTAAATGAAAAAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>13974 348 1810    21q21.1    chr21:17254862-17255209 BLAT!
TTATTTTGCAGTATGTTCATTTAATACCTAGTTTATTGAGAATTTTTAACATGAAGTGAT
ATTGAATTTTATCAGAGGCCTTTTCCACATCTATTGAGGTAATCATGTGGTTTTCGTCTG
TAGTTCTGTTTATGCAATGAATCTCATTTATTGATTTTTGTATGTTGAACCAACCTTGTA
TCCCAGGAATGAAGCCTACTTGATCGTGGTGGATAAGCTTTTTGATGTGCTACTGTATTC
AGTTTGCCAGTATTTTGTTTAGGATTTTTGCATCAGTGTTCATCAGGGATATTGGCCTGA
AGTTTTTGTTGTTGTTGTTGACGTTGTATGTCTGCTAGGTTTTGGTAT


invisible?    
Gene introns: 0   Nearest EST: 0

>17598 160 250    21q21.1    chr21:18520240-18520104 BLAT!
CGCCATGCTTTCGATCCCCCCGCGTACTATTCTAGGATAGGTTTTTTAATTCCTTCAGCT
CTTTAACTATGTCATACCACTCTCTCCCAGCATGTAAAGTTTCCACTGAAAAGCCTGCTG
GTAGATTTATTGGATCTCCTTTGTATGTTGTTTCTTTTAT


invisible?    
Gene introns: 0   Nearest EST: 0

>8003 141 460    21q21.1    chr21:19910371-19910511 BLAT!
GCCATACATTAAAGATGAAGAAAAATATGGAAATAGCTCAAGTTACCTCCCCAACATTAA
AACAAACAACCCTCAGAGAAAACTCACCAGTTAACGAGGAACTAGAATTTTGAACGCACT
GTGAAAAAAACTAAAACAAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>12392 120 176    21q21.1    chr21:20950377-20950258 BLAT!
AAATTGTATATGCATAACTAAGTAAAAATACAATGTTTATTTAAATAGGGTAAGAATTTG
CAATTGATATAATTTCACTTATATCTTTGTAATTTTCTTATGATTATCCTTTGTATGCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>1926 327 1479 14625+,79599+,46941+    21q21.1    chr21:21132127-21132009 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGATGTCTGGAGGTTGGGAGCTGGAACTGAATG
GGACAGAAGCGAAATTAGTGCGGAAAGTTGCCGGGGAAAAAATCACGGTCACTTTCAACA
TTAACAACAGCATCCCACCAACATTTGATGGTGAGGAGGAACCCTCGCAAGGGCAGAAGG
TTGAAGAACAGGAGCCTGAACTGACATCAACTCCCAATTTCGTGGTTGAAGTTATAAAGA
ATGATGATGGCAAGAAGGCCCTTGTGTTGGACTGTCATTATCCAGAGGATGAGGTTGGAC
AAGAAGACGAGGCTGAGAGTGACATCT


invisible?    
Gene introns: 0   Nearest EST: 0

>8961 103 203    21q21.1    chr21:22330708-22330810 BLAT!
GTCTCTTTAATTTTTAAAACAAACAAAAAAAACCAATAAATGTAATCCATCACATAAACA
GAACCAATGACAAAAACCACATGATTATCTCAATAGATGCAGA


invisible?    
Gene introns: 0   Nearest EST: 0

>11459 115 203    21q21.1    chr21:23931117-23931231 BLAT!
CGTGAGCCACCGCACCTGGCTGTATGTCTTATTTTCAAAAGTGTCTGTTAATGTCTTTTG
CCCACTTTTCAATGGGATTGTTTGGCTTTTGCTTATAAATTTGTTTAAGCTCCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>21934 140 307    21q21.2    chr21:25194150-25194289 BLAT!
AGTAGAGACGGGGTTTCACCGTGTTAGCCAGGATGGTCCGCCTGCCTCAGCCCCCCAAAG
GGCTGGGATTACAAGCGTGAGCCACCGCGCTCAGCCAACTTCTCCCTTCTTAAGAGTCCG
CTGTGCATTGTGACTTCAAT


invisible?    
Gene introns: 0   Nearest EST: 0

>18808 132 201    21q21.2    chr21:26527666-26527535 BLAT!
AGTCCAAAATCCAGGGGGCAGTCAAATCTTAAAGCTCCAAAATTATCTCCTTTGACTCCA
TGTCTCACATCCAGATCATGCTGATGCAAGAGGTGAGTTCCCATGGTTTTGGGCAGCTCC
ACTCTATGGCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>9633 185 353    21q21.3    chr21:29067126-29067310 BLAT!
AGCTCCTTTGAGTCTTGATGGTAGAGTCACATAATCTCAGGTCTGCACGGCATTCCCATT
TACGGTGTTTCTCCACCAGGGAAAATTGGTGAAACTCAAAGTTCCCAGGATGATGCTGGG
AAGAACTTAGAGATAAAACATGCACTGCCTAAGAGGAGTGGAATGTGAATGGAGATGAGG
CTGTA


invisible?    
Gene introns: 0   Nearest EST: 0

>5476 134 230    21q21.3    chr21:29814549-29814682 BLAT!
GAGAAGAGACTATTACATTGTGGCCGACTAAATTCACCACATCCCACGTGGTTGTATACA
CACAACCTTAGGAGAATTGCAAGAAGCAAGTTTGTCAAAGTGAAACCAAAGAGTTTGAAA
AGTGTCCTGTAGCC


invisible?    
Gene introns: 0   Nearest EST: 0

>16123 228 881    21q21.3    chr21:30122101-30122328 BLAT!
TCTGTAAGAAATTAAAATGAACATAACCAGAGAGAGATAGGGTATCTCTTACGAGAACAT
CAGAGGAGCGTCTACAGCCATGTAATGTTGACATTCACTTCCAAAAACTGGCATATTCTC
TAAAAGGACAGCAAACTGGATTGACATGCCAAAACCACTAGTTGAAAAATAAAAATAATC
CGTTATTAAGTCAGTTGTTTTGTCATTGCTATTTTCACCAATCTAATT


invisible?    
Gene introns: 0   Nearest EST: 0

>11914 161 282    21q22.11    chr21:34757323-34757163 BLAT!
AGTCCTTCGAATTCTTCACTCTTGACAGAGAAGACAAAGGACCTGTGGTTATTATGTTAT
AACCACACAGTATCAAAGGTTACTTAGCTAAGTGTGAAAGTAACAGTAAGCGCCGCGAAC
ATCAAGGAAACTCAGGAAACTCTTCCTCGAAGCCTTTTGAT


invisible?    
Gene introns: 0   Nearest EST: 0

>13149 293 5267    21q22.12    chr21:36972322-36972035 BLAT!
AGATGAAGCTGACAGAAGAGGGAAAGTGTATGATAAATACATGTGCAGCTTTCTGTTCAA
CTTGAACAATGATTTTGTGGTGGATGCAACCCGCAAGGGTAACAAAATTCGTTTTGCAAA
TCATTCGGTAAATCCAAACTGCTATGCAAAAGTTATGATGGTTAACGGTGATCACAGGAT
AGGTATTTTTGCCAAGAGAGCCATCCAGACTGGCGAAGAGCTGTTTTTTGATTACAGATA
CAGCCAGGCTGATGCCCTGAAGTATGTCGGCATCGAAAGAGAAATGGAAATCC


invisible?    
Gene introns: 0   Nearest EST: T99536 (36972319 - 36972531)

>12697 154 476    21q22.12    chr21:37192691-37192844 BLAT!
GCACAGAACAAAAGGCAGGGGAAGGAGGAATTGATCCTTTTTGCTTCCTGCCCACCCACC
TGAGCTGCTACAGCTCATCTGATCTCCTGCCCTTAGACTGGGAGCTACAACACCAGCTTC
CGTGGTTCTCGGGGCTTCGAACTTCTCCTAAATT


invisible?    
Gene introns: 0   Nearest EST: 0

>5123 116 181    21q22.2    chr21:40539306-40539421 BLAT!
CTAGTTCATTTTTGGTGCATAGAAACCCTATTTTTGTATGTTCATTTTCTATCCTGCAAC
ATTACCAAATTTGCTTATCAGCTTTAAGTGTGTATTTTGCTTTGCTTGTAGAGTCT


invisible?    
Gene introns: 0   Nearest EST: 0

>2327 390 11566 52717+,63925+,24579+    21q22.3    chr21:45276133-45275769 BLAT!
CGGCCGAGGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAAC
GCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTG
GACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACC
TATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATG
GGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTA
GAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGAGCTCGTC
CGCATGGTGCTGAATGGCTGAGGACCTTCC


invisible?    
Gene introns: 0   Nearest EST: AA577819 (45276082 - 45276306)

>16251 137 2706    21q22.3    chr21:45276133-45276018 BLAT!
CGCGGCCGAGGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCA
ACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGC
TGGACTTTGAGCACTTT


invisible?    
Gene introns: 0   Nearest EST: AA577819 (45276082 - 45276306)

>11655 129 238    21q22.3    chr21:48011532-48011404 BLAT!
TGTATTAGTCAATTTTTACATTGCTGATAAAGACATACCCAAGACTGGGCAAAGGAAAGA
CTGGGCAAAGGAAAGGCTTTACAAAGGGAAGAGGTTTAATGGAGAACTCAGTTTTACATG
GCTGGGGAA


invisible?    
Gene introns: 0   Nearest EST: 0

>17434 134 309    21q22.3    chr21:48089432-48089565 BLAT!
GCTGGAGACTCCCAAAGGAGGCAAGCAAGCCTCAGCGATCCCAGGAGGCCCCATCGGCCC
TTCCCAGGCTTTCCTCTCTTTAAGCTCCTCCTCCTCCTTCCCTTTCTTCAGAATCGAATC
TAGGCAAGGATTTC


invisible?    
Gene introns: 0   Nearest EST: 0

Databases: ABC1_contigs // chromosome: chr21