Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr1

Shown 1-30 from 231 sequences on 1 of 8 pages.
Pages:  1  2  3  4  5  6  7  8

>12962 161 353    1p36.33    chr1:47401-47561 BLAT!
TAAAAGAATATCTTGACACACATTAAGCTCACTGACCCCCACACCATGAATGAGGGCATC
TTCAACAATGGTGGATGACGTCTTAGTTTCCCTCAACTCAGTTAATCTAAGTAAGCTCAT
GGTATCACTTTCCTGTCCTAGAGGGAACATATTTCCTGCAT


invisible?    
Gene introns: 0   Nearest EST: 0

>12667 151 443    1p36.31    chr1:5518357-5518507 BLAT!
CCGCAAGCAGGATTGAATCTGCCGGCCACTGTTGTTCCCCTCCCTTCCTCCTTCTCTCCC
TCCTTCCTTCCCTCTTTCCTCTCTCCTTCCTCCCTTCCCTCCTTCCCTCCCTCCTTCTTT
CTTTCCTTCCTTTCTTCCTGTTCTTCCTTCC


invisible?    
Gene introns: 0   Nearest EST: 0

>31429 150 481    1p36.31    chr1:5518712-5518861 BLAT!
CCCCCCCCCTGCAAACCCATGGTCTGGGAAGACAGTGACTGCATGGCGGAGCCCGCACCT
TCTGTTTCTGGGAACCAGGTTTGCTCAGAGGGACCCAGGAGGCAAGGGGGTGGCCTGAGA
ACACGTCTCAGAATTACTCTCAGAAGAGCA


invisible?    
Gene introns: 0   Nearest EST: 0

>21790 146 281    1p36.31    chr1:5875562-5875417 BLAT!
CCACTGGGCATTTCCCTGGCAAGGGAAACAAACTACACTCCCCACGATGGTCAGCTGCTG
AGGCAGGCTTATTAGGAAATGCTCCAGCAGCAAGGGCATCAGGGAAGCAAGAGATCAGCT
TGTTCCCCTTTCCCAGGCTTGGGATA


invisible?    
Gene introns: 0   Nearest EST: 0

>22222 102 179    1p36.31    chr1:5875982-5876083 BLAT!
GCAAAAACCGCAATTACTTTTGCACCAATCTAATACAAATGATAATTAATAAACAAAAAT
CAACATTTATTAAATGCTTATTCTGCACCAGATAATGTGCTA


invisible?    
Gene introns: 0   Nearest EST: 0

>32986 134 235    1p36.31    chr1:5876159-5876282 BLAT!
ACAGAAGAAAAATTAGGCATAGAAAGGAAGTATCTTGCCCAATGCCATACGTTCAGGAGT
GACAGACTAGGACTGAAAATCAGGCAACATTCTATCCTCTGCCCCTGAAGAGACTCAGAT
GTACACTTCATTGC


invisible?    
Gene introns: 0   Nearest EST: 0

>11333 240 1081    1p36.21    chr1:13021226-13021438 BLAT!
GTATATGGTGACTTACTTTCCAATCTGACTCTGGCATAACATCCTGTGACAGAGGAGAAA
GTCAAGATATTTTGCCCCAAGGCATGTTTCTTTGCCATATCTTGAAATGGCCCTGCAAAG
CTGTCCTTTATGGGGGAAAATCTGCATCTGTAAAGAATCTCTATTAACACAGCTAGATCT
TTTTCTTGCAGGCCCTCCCAGTCCTGAAGAGATTAAGAGTCTAGCACCTTTTAAGGTCTG


invisible?    
Gene introns: 0   Nearest EST: 0

>24556 206 655    1p36.21    chr1:14223253-14223048 BLAT!
TTAGCCCCAGTTGTCACCAGGGACTATGCAATTTAGAGGTTAAAGGCAAAGGCCTGAGCA
TCAGACCAAGGCTTTCCTTCCCAAATGGTGTGAAGGTGGGCATGCGGGCAACCCCTGTGT
ATTTCCTTTGCCTATGGAAATTGGGTAGGATTTTTAAAAATTACAGGAGCCTGGCATGGT
TGCTCACTCCTATAATCCCAGTATCT


invisible?    
Gene introns: 0   Nearest EST: 0

>18140 186 1189    1p36.21    chr1:14223343-14223528 BLAT!
GGAGGGGGCTGAGCACTAAAGGGCGCCTAGGATTTAGTGGGGCAGCAGAGATAGGTTTCT
TGGAGGCAGGGCAAAATTGGGCACAGATGAGACCAATAAAAGCTTTGACCCAATTAGCAG
TAGTGGGAGCATGAAGGTCTGGTGGGGCCATGGGAAGAGCATGTGGTTCTTTCTCATTTA
GTCCCA


invisible?    
Gene introns: 0   Nearest EST: 0

>23991 154 538    1p36.21    chr1:14468714-14468867 BLAT!
TCTTCTACTGAGATGTCTAGCTGTGCCCGCTTGAAGTCTTTAAAACCTCCATTTTCAAAA
CCTCCTGGTGCATGCACAGTTAGAAGCGTTTAAAATTCCAATAAAATACACAGTCTAAAA
ATGTCTTAGCTTTTAGCTACCAGGTTGTTCCTAA


invisible?    
Gene introns: 0   Nearest EST: 0

>3951 112 285    1p36.21    chr1:14549680-14549791 BLAT!
AGTCACAGGACAAAGCAAGAAACACCTTTTGGGGCACTGAACACCTGTTATCTTGCTGAA
ACAAAGATGGCAGCCTGAAATGGTTGTTAGCATCAAGTTCTTTTGAAAATGC


invisible?    
Gene introns: 0   Nearest EST: 0

>24654 188 422    1p36.21    chr1:14550322-14550135 BLAT!
GATTGGACCCAGGGTGGACAAATCAAGCCAGATAGATGAGGTTTCCCTCATGTGCAAATA
CTCTTAATTAATCCAGTGTTTCTCCTTTCGTATCAGTTTCATCGTCGAGAGTCTTGTATC
ATCTGAAAATTCAGTTTAAAGAAGCTTAACTGTAATTTATGCAGGATTTCTTGTCAAATT
TGGCCTAA


invisible?    
Gene introns: 0   Nearest EST: 0

>25209 175 612    1p36.21    chr1:14550566-14550740 BLAT!
ACTTCCATGGAGAGAAATTTTTTAAAAACTTCAGGGGTGAACAACTGCCAAAAAGGAATG
TCTCATACCCAACTGTCATTGATTTTTATGTGAAAGTCAGTAGTTATTTCGGTGTAATGC
CCAGGATGCACATGAGAAGCTCAGATTTCATAAAGGCCAAAGGGGCAGGGTCTAG


invisible?    
Gene introns: 0   Nearest EST: 0

>1274 161 1067    1p36.21    chr1:14578437-14578277 BLAT!
GCACAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGATCGAGGCAGGTGGATCACTT
GAGCTCAGGAGTTCAAGACCAGCCTGGGCAACATAGTGAGACCCCGTCTCTACAAAAAAT
ACAAAAATTAGCTGGGCTTGGTTGCATGCATCTGTAGTCCC


invisible?    
Gene introns: 0   Nearest EST: 0

>17015 222 3177    1p36.21    chr1:14579006-14579227 BLAT!
TTGTTCCCTCTGCCTGGAACATTCCTGTCCAGCAACTCAGGCAACTCATGCTCTTCCTTC
AAATATCAGTTCAGGGGCTGCCTACTGGGGTTGCTCTGTTGGTATACATTCCCTACTCCA
TCCTATTCCATATAGCTCTTAGGAGGATTCAAATGCTTAAACAAATCTTTAGACATACAC
TTGATGGGTATTAGCTCTAATAATGTTTGCTATATTATTAGT


invisible?    
Gene introns: 0   Nearest EST: 0

>6795 150 238    1p36.21    chr1:16154871-16155001 BLAT!
GAGCGGCCGCCCGGGCAGGTACAAGCTGCTGGAGCCAGTTCTGCTTCTCGGCAAGGAGCG
ATTTGCTGGTGTAGACATCCGTGTCCGTGTAAAGGGTGGTGGTCACGTGGCCCAGATTTA
TGCTATCCGTCAGTCCATCTCCAAAGCCCT


invisible?    
Gene introns: 0   Nearest EST: AA079081 (16154728 - 16154968)

>18677 124 437    1p36.13    chr1:19661654-19661531 BLAT!
ACTGCGCCCAGACTGAAGCCTTTCCTGAGGTTCTCCTGGGGCCCCAGGTTCAAGACTCCT
AGTCTCCCAAGATTTTCTCCTGCATTCAGATTACTTTCTGGGTAACTGCTTTGTGGCAGG
CCCT


invisible?    
Gene introns: 0   Nearest EST: 0

>15784 146 565    1p36.13    chr1:19662339-19662484 BLAT!
GGAGTCTGTAGCCTGCAGCCCATGAACCCCAGGGGCTCCCATACGCCTTCGTTCTCTTCT
TAGGGATGCCCGAGGTGCCCTGCTGGACCCCAGAGCTTTCCTCACCAGGCAGCCAAGGAA
CGAGCAGGGAAAGGCATGGCTGGGAA


invisible?    
Gene introns: 0   Nearest EST: 0

>16126 108 177    1p36.12    chr1:22001982-22002089 BLAT!
TTCTAAATGCAAAGAAAAATACAAAGCCTTTTACCTCAACAATATTTATTACTGTTTAAT
CCTCTGAGTGTAGTAAACAAAAATAGCAAATACTGCTATTTTGAGAGA


invisible?    
Gene introns: 0   Nearest EST: 0

>9131 158 329    1p36.11    chr1:26982556-26982698 BLAT!
AGGCCGAGGCAGGCAGGTTGCCTGAGTTCAGGTGTTCGAGAACAGCCTGGGCAACATGGT
GAAACCCTGTCTCTAATAAAATACAAAAAATTAGCTGGGTGTGGTGGCGTGCGCCTGTAG
TCCCAGCTACTCAGGAGGCTGAGGCACGAGAATCACTT


invisible?    
Gene introns: 0   Nearest EST: 0

>23814 104 1043    1p35.2    chr1:30648051-30648131 BLAT!
AATTTTTGTATTTTTAGTAGAGATGGAGTTTCACCATGTCGGCCAGGATGGTCTCAATCT
CCTGACCTCTTGATCCCCCCGCGTACCTGCCCGGGCGGCCGCTC


invisible?    
Gene introns: 0   Nearest EST: 0

>18829 126 229    1p35.1    chr1:32889573-32889448 BLAT!
ACTGTTTGTCCAGAAGATTTCAGCTAAACTGGCAAACAGTTACAGGACGCGGTTAACATG
TCTGCTAACCTTGCTTAACAAAGCTGGCAAAAACATCTCCAGGAAGCAGGCAGAACACCT
GCTCCC


invisible?    
Gene introns: 0   Nearest EST: 0

>9407 152 389    1p35.1    chr1:32890666-32890817 BLAT!
CTACCTCCTCTGGAGACTGGGTTGGGGCCTGCTGCTGGGCTGGAGAAGATTCAGTCTCCT
TGGTAGGCTCTGAGGTTATAATAAGCTCTGCATCCACAGGTTTAACTGTAACAGTGGGCA
AGTTATAATGAGCTTGATCCTCACCAAGAGGG


invisible?    
Gene introns: 0   Nearest EST: 0

>19989 166 925    1p35.1    chr1:32993997-32994162 BLAT!
AAAACAAAAAAGTGCCCTTAGACTGCCAAACGGGATAGTTAAGAAAAAATCTACACGTAG
GCACATTACAATAAAATGTAAGAATAGCAAATACAAAATGTAAGAACGTCAAAGACGGCC
AGGCGTCGTGGCTCACGCCTGTAATCTCAACACTTTGGGAGGCCAA


invisible?    
Gene introns: 0   Nearest EST: 0

>1442 159 923    1p35.1    chr1:32994008-32994166 BLAT!
GTGCCCTTAGACTGCCAAACGGGATAGTTAAGAAAAAATCTACACGTAGGCACATTACAA
TAAAATGTAAGAATAGCAAATACAAAATGTAAGAACGTCAAAGACGGCCAGGCGTCGTGG
CTCACGCCTGTAATCTCAACACTTTGGGAGGCCAAGGCG


invisible?    
Gene introns: 0   Nearest EST: 0

>547 144 686    1p35.1    chr1:33965434-33965296 BLAT!
GTATTGCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACACAAGACCCCCATCTCCCC
CCCAAAAAAAATGGGGTAAGGGAATATTTTGAATGATTAATTTTGACTTTAGATATTGAC
TTCATTCAGAAAGAGACCTCTCAG


invisible?    
Gene introns: 0   Nearest EST: 0

>6138 162 714    1p35.1    chr1:33965434-33965273 BLAT!
GCTTGAGGCCAGGAGTTCAAGACCAGCCTGGGCAACACAAGACCCCCATCTCCCCCCCAA
AAAAAATGGGGTAAGGGAATATTTTGAATGATTAATTTTGACTTTAGATATTGACTTCAT
TCAGAAAGAGACCTCTCAGGCAGCTGGGTAACTCCAGCCCAA


invisible?    
Gene introns: 0   Nearest EST: 0

>18861 120 294    1p35.1    chr1:34044397-34044516 BLAT!
AGCCACCCCTGGTGAGGTCCCCGGCCTCTTTCTTGGTGATCATATCCCTCTGCCGGTGAA
ATGGTTGTTTTAAATAGCTGCCTTCCAAGCCGAATTTGTTTCCCTACTCCTGCTTTGCCC


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)   Nearest EST:

>7625 199 513    1p35.1    chr1:34045255-34045057 BLAT!
GGAATGTCAAATTCAGTGCCTGAAGTCCCACTTGCCACAGTCCATCTCTTCTCATGGGTC
TCCTACTTGCAAGACCAGCCCATACTCAGTGGGTGGACAGTCTTAAAGAATCCCTGGGTG
TAGCTTTCAGGGGAGAGCCAACCAGAGGAAGCTGAGGGCCCCTGGGAGAAGGTGGGTCTT
GACTGTCTCAGAGCCCATA


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)   Nearest EST:

>13245 190 858    1p35.1    chr1:34046098-34046287 BLAT!
GATCACTGTTAGGCATTATCAGATCATATAAAATTGTTAAACTTATCCTGAAGACAAAGG
CTGGCAGTATGAGAAAAGAGGGAAGAGGTTCAAGAGGGGAATGGAATAGAAAAATAGGAG
GTAGGGGAATGGCAAAGACCACTTAGCTTCAGGTGAGGCAGATTTAGGAGGGGAATGGCC
GCCCGGTCTC


invisible?    
Gene introns: CSMD2 (33979608 - 34631443)   Nearest EST:

Shown 1-30 from 231 sequences on 1 of 8 pages.
Pages:  1  2  3  4  5  6  7  8

Databases: ABC2_contigs // chromosome: chr1