Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr10

Shown 1-30 from 120 sequences on 1 of 4 pages.
Pages:  1  2  3  4

>25435 100 226    10p15.3    chr10:2280541-2280442 BLAT!
ACTCATTCTCATTCTTGCCACCCTGTAAAGAGGTGCCTTCTGCCATGATTGTAAGTATCC
TGAAGCCTCCCCAGTCATGTGGAACGGTGAGTCAATTAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>5298 140 258    10p15.3    chr10:2281122-2281261 BLAT!
ACAAATATGCCTCATAGATGCCAGCTGGTGAGGTTAAATCAGAGTCTCTGCCTTCTAGAA
ACTTGTAATTAGTCAGAAGATATGAGGCACATTCATAGATGGCCACTGTTTAGGCACACT
CTGGATCATGTATGCCCAAT


invisible?    
Gene introns: 0   Nearest EST: 0

>20736 171 348    10p15.3    chr10:2281739-2281909 BLAT!
AAAATGTCAGAGCGCAGTGAAGCAGAGGTTACCGTATTAATTTTAATTAACAGTGAAAAG
GACCCCACAGCACCTCTGCCTCTGGCCACACCCTCACCCATACACAAAGACAGAATAAAG
GCTCAGATTCTAAGGTGGTCATAAGCTGGTTTCCCCACCTCCCCAGTTCAT


invisible?    
Gene introns: 0   Nearest EST: 0

>23787 115 215    10p15.3    chr10:2842329-2842215 BLAT!
ATCTCACACCATCCTCCCATGGTTAAAGGAGCAAGGCAGCTCCCTGGGGTCCCTTTTACT
AATCTCATTCTTGAGAGCTCCATCTCATGTCCCAATCACCTCCAAAAGTCTCCAC


invisible?    
Gene introns: 0   Nearest EST: 0

>32140 221 959    10p15.1    chr10:3862615-3862395 BLAT!
CAAAGATCAGTGGCCCCCGCTCTAAAGATTAAAGGAGCATTCAAGTGTGCTTACATCATA
AACTCACTTACTTAACTCCTGTCACCTCTGAAAGCTCAAAACCATTTTTGTCCAACTCTC
TACTTCCCCCATAGTGGGTTGGACCACTGGTCACCATGGTGTTGTCCTTACAGATTTTGC
TCTGGCTGAGCCACGTTTTGAAGGTGACATCAGATAATGAT


invisible?    
Gene introns: 0   Nearest EST: 0

>19053 144 391    10p15.1    chr10:3862967-3863110 BLAT!
CAAACTCGCTGAGAAGTTTATATTGGAAGATGCTGAATGTAAGGGCAGAAAGCAATGCTA
TCCCCAGAAGAGATCAGCGCCTGAGCCTGAGAAGTCATCCAGAGGGAGGCAGGGCCCTTC
CTCAGATCCCACGGGGTCTGGGAT


invisible?    
Gene introns: 0   Nearest EST: 0

>14343 248 4210    10p15.1    chr10:4244710-4244463 BLAT!
TTTCTTTGATGCCTTATCACCTTGGCCTGCCTTCAGCAAAGATTTGTTGTTATTTTTGTT
GTCATTTGTTTGTTAGTTTGTTTTATTGAAACAAGGCAGATTCTAGGCTTTATGATTAAA
CTCTAAACTAATCCACAGGCTGAGGGCCAGATATTCTCTCACCACAAAGCATGAGCACAT
ATAAGTTCAGTCCCATGCCACAAACATCTGTGGCCCTTTCAAGCCAGATGTGAAATCACA
TCCTGACC


invisible?    
Gene introns: 0   Nearest EST: CN479565 (4243910 - 4244634)

>16617 102 216    10p15.1    chr10:4244710-4244609 BLAT!
TTTCTTTGATGCCTTATCACCTTGGCCTGCCTTCAGCAAGGATTTGTTGTTATTTTGGTT
GTCATTTGTTTGTTTGTTTGTTTTATTGAAACAAGGCAGATT


invisible?    
Gene introns: 0   Nearest EST: CN479565 (4243910 - 4244634)

>27270 134 447    10p15.1    chr10:4244820-4244953 BLAT!
GCGAGGATGGGAGCCAACGTGGAATCCTCATTGAAAAAAGGGCTGAGAAGGCCCTAAGGA
ACGTTGTCAAGGAGAGAGACTTTGTCATGCCAAAGCTTAGGATGGCAACTTTATGAAACA
TAAGCTTGAGATCC


invisible?    
Gene introns: 0   Nearest EST: 0

>1483 373 11692    10p15.1    chr10:4244853-4244502 BLAT!
GGGCCTTCTCAGCCCTTTTTTTCAATGAGGATTCCACGTTGGCTCCCATCCTCGCTGGGC
CTGCATACCTCCTTTTCAGCAAGAATCCTGCTGAGGCAGTTTCACAAGAACTTCCCACCC
TTAATGCCTGATCATCACAGGCATCCTATCAAATTTCATACCCCTTTCTTTGATGCCTTA
TCACCTTGGCCTGCCTTCAGCAAAGATTTGTTGTTATTTTTGTTGTCATTTGTTTGTTAG
TTTGTTTTATTGAAACAAGGCAGATTCTAGGCTTTATGATTAAACTCTAAACTAATCCAC
AGGCTGAGGGCCAGATATTCTCTCACCACAAAGCATGAGCACATATAAGTTCAGTCCCAT
GCCACAAACATCT


invisible?    
Gene introns: 0   Nearest EST: CN479565 (4243910 - 4244634)

>1695 100 15844    10p15.1    chr10:4245168-4245096 BLAT!
ATAGGGCTCGAGCGGCCGCCCGGGCAGGTACAGAAAAAGTGGGTCAGTGCCAAGGGCATC
TCAGCCTGTTTGGAAGAATTCAAAATCATTTAGGTAAAGG


invisible?    
Gene introns: 0   Nearest EST: 0

>21059 133 359    10p15.1    chr10:4245502-4245634 BLAT!
TTTTTTGCTTTAATCCTTTGACTTGTAGTAGAAAATTGCTTTTAAGTAAGAAGTTTCCAA
AATAGTTACACTTAAAAATAATGTTCCTTTTATACATTTGTTGTGGAAAGGCACTAAAAA
ATGCAAAATCGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>19022 375 7643    10p15.1    chr10:4245507-4245165 BLAT!
AAAAAAAAAAGGTGAATCTGCAGCAGCATATATTGTATATGTTTTCTAGAAATACTTTTT
TAAAGAAGGCAGAGAACCCTAAGCTAAAAGCAGAATTTAAATTTCTAGCATTCATTCAGC
AGCTGTCTCTATAAGGAGACAGGGTTGAATTGTGTCCAAGTCAAGCATCAGATTTCCAGG
GAAAGCAGAGGAGAAATTAGAAAATGTGCAGGAAGCAGCAGAAATGGCTGTTAAAAGGTG
ATAGCCTTCTAAAATTGACAAGACTTCTTGGGTCAGATAACAGATCCAAGGGCTAGAGGT
CTGAATTCAGGCATGGTCGGGGGAGGAGGAGGGGGAAGTGTACCTGCCCGGGCGGCCGCT
CAAAGATCGGAAGAG


invisible?    
Gene introns: 0   Nearest EST: 0

>24300 313 11090    10p15.1    chr10:4245633-4245945 BLAT!
TGAGGACAAAAACTTCCTTTGATTTAAACCTATTGGTGACTCAAACAACTTGCCTGAAAG
GAATTTACTTTCTTTAAAGCAAATCTTATGCAATATAATGTCCCTTGACAAATTAGGGGA
CATTAAATATCAGTGAGGGTTCTGCTCATTTTTGGTTCTTCCTAGTGCACGTGCTGAGTG
TTCAGCACACTATATTTTATTGAATTCTCCAAGCTACTATCCATGGTCCTATTTATAGAG
GAGGAGGAAGCGGGGGCTCTGAGGTGGGATCAACATGCTCATGGTCACCCAGCAAGTAAG
AGGGGACCCATTC


invisible?    
Gene introns: 0   Nearest EST: 0

>14166 147 1025    10p15.1    chr10:4246288-4246142 BLAT!
TCCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGTGCCTGACCAACCTGAAGCAATTTA
AGTGGACTTTCAAATTTTCAATTTTCCCATTGGGAAAGTGTAAGTTTTGGGAAAAGTCAG
TAGTTTTTACATTCTTTTGTTCTGATG


invisible?    
Gene introns: 0   Nearest EST: 0

>4003 126 536    10p15.1    chr10:4246310-4246435 BLAT!
TGAGGTCAGGAGTTCGAGACCAGCCTCACCAACATGGAGAAACCCTGACTCTGTTAAAAA
TACAAAATTAGCTGGGCATGGTGGTGCACACCTGTAATCACAGCTGCTCGGGAGGCTGAG
GCAGAA


invisible?    
Gene introns: 0   Nearest EST: 0

>21857 134 263    10p14    chr10:8117556-8117689 BLAT!
TGTTTTGCTTTTCTACTGTTGAATGAATACCACCACAGTGAAGGGATTATTGGAATGTTT
TCGAAACACAAAATAACCATTTTGTAACTTCTGCTGTATAGTTTTCTTTTCCTGTGGATG
GAGTGTGTAACTAC


invisible?    
Gene introns: 0   Nearest EST: 0

>7595 217 1074    10p14    chr10:8288159-8287943 BLAT!
CAAGGAATCATCAAGTTTTAAAATCTCACAGTCCTAGGACTCTAGAACCTAGGACCCTGA
CATCCAGTATGACAGCCTTTACGTTAGACCAGTGATTCTCAAAAGGTGATCCCTGGACCA
GTAGCAGCATATTACCTGGGAACTTCCTGGAAATACAGATAATCAGGCCCTACCCCAGAC
ATACTAAATCAGAAACTCCGGTGGTGTGGCCCAGCAA


invisible?    
Gene introns: 0   Nearest EST: 0

>15620 247 3443    10p14    chr10:8288224-8288470 BLAT!
ATAGGCTTTGCTGGCCATCTGGTGTCTTTTGCAACTACTCAACTCCACTGTTGTGGTATA
AAAGCAGCTGTAGATAGACACATGCAAACAAATGAGCATGGCTGTGTTCCAATAAAACTT
TACGTTTCCATAGACAGGCAGCAAGCCAGACATGGTCCATGTAGTTTGCCAACCCTGGTC
TAGTCTAAGCTTTCATTTTACAGACGAGGAGATTGATTTTCAGAGAGGTTAGTTGACAAT
GACAATT


invisible?    
Gene introns: 0   Nearest EST: 0

>5912 103 261    10p13    chr10:16167681-16167579 BLAT!
GGTATATGGGCCAGTTGGTGTTTGGTTGATCAAAGCTGGAGTTGACTGGCCTTGGCTCTA
AGATGCAGACTGAGCTCAAGTTTTCTCTTCTTCTCTCACCCTC


invisible?    
Gene introns: 0   Nearest EST: BU664696 (16167041 - 16167676)

>8437 146 337    10p13    chr10:16168523-16168668 BLAT!
TTTATTTATCTTGGTGTCAAAATTGCTACAACTGAAGGATACTAAGTTTCCACAAACTCT
AAGGCAAAACTTCAAAGAGTTACAAATACTATTAACAGGGAATTTGGACCTAAAGTAGGA
GAGAACAGTAGTTCTCTTAGGGAGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>6128 105 222    10p13    chr10:16198323-16198427 BLAT!
AAAGCACTTTTCTGAACTAGGAATAATCTCAGACTATAATATCCTGAGTATGGACAAAGG
TCGCCAAAGCTTAGGGATATGAGGCTGTCAGTGTGAGATTCAAAG


invisible?    
Gene introns: 0   Nearest EST: 0

>27811 111 250    10p12.33    chr10:18037623-18037513 BLAT!
ATTACAGGTGTGAGCCACTGCTTCCGGTCACCTTTACAAGATTACCCCATGAGTGTTAGC
ACTCATGTGACGTGACCTGTGACCAGTGTTTTCTACCTCCTGGAATGCCCT


invisible?    
Gene introns: 0   Nearest EST: 0

>9234 162 407    10p12.31    chr10:19181791-19181630 BLAT!
TGGAAGCCAAACGTCTGAAATCAAGGTGTTGGAGGATGGGTTTCTTCTGGAAGCTCTGAA
GAATCTGTTCCATGCCTCTCCTAGCTTCTAGTGGTTGCTGGCAATCCTTGATGGTCCTTG
GCTTGTAGACACATCACTGTGATCTCTGCATCTGCCTGCACA


invisible?    
Gene introns: 0   Nearest EST: 0

>20618 101 227    10p12.31    chr10:19915821-19915721 BLAT!
TTCCAACTGAACATTAAAATCCAACTGCCTATTTCAAAATCAAACAAAAATCTAAATTAT
TAACTAGATTTAATTAGCCAATGTAATTAATTGGCTAATGG


invisible?    
Gene introns: 0   Nearest EST: 0

>19902 144 383    10p12.31    chr10:22336005-22335862 BLAT!
ATTTGTTTGTTTGTTTTGTTTTACATTCTTTCCAATCTTTATACATTTTATTTATTTTTC
TTGTCTTACCACAAAGGTTATTCCTGTCACCCAAGATGAAAGAGAAGCAATAATTGAAGC
TATTCTTACCTCATACTTAATTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>18136 233 564    10p12.2    chr10:23414903-23414671 BLAT!
ATCATATACCTATGATAATGAAAGCATATCAAAATTTGTGGGATGTAGGGTAAAACAGAA
CATATAGGGAAATATGTAGCTTTAATGCCTACATGGGAAAAGAAGCAAAGTCTAAAAATA
AAGCTCAGTGATCTAAGCTTCCACCTTAAGAAATTATAAAAATAAGTCCAAGTTATGCTC
AAAGTAAACAAAAGGAAGGAAAGGATAAAGGGTAAAAATCAATAAAATAGAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>29520 172 410    10p12.2    chr10:23858897-23858726 BLAT!
AATGCCCCATGGTATCAAGCTGATTCAAGGTTAAATTGATTAAGTATAGATCACATTGAC
AAAGAGATACAATTAAACAAAGGCTCGAGTCTGGAGAGTAATTAAAAGCCTCCTCCTTAT
TCAGCAGTCTAAGCTCCAAAGTTAGAATCAGGACATAGGAGGCCGAGCACAG


invisible?    
Gene introns: 0   Nearest EST: 0

>5929 183 1084    10p12.2    chr10:23859764-23859946 BLAT!
CTGGAATGAGTAATCAGCAGTGTTGATTCCAAATCTTAGTGAGACCTGTGCCAAACCTTG
GTTTCTGGGAGTCTTCACAAGCATCATGAATAGATGAAAGTTTTTATATTTAGTTGTTGT
GCTGTTTCACTCCAATAGCAGAAAGAACAAAGAACAGAGACAGATGGGGAGTGGAGCAAG
ATG


invisible?    
Gene introns: 0   Nearest EST: 0

>19119 120 233    10p12.1    chr10:25670691-25670810 BLAT!
CTTATTTTGTTTAGCATTTTTTATTTTAAACAACAATTTATTTTAGCAAAATATTTAAAG
AAGGACTACTCAAAAACAAACAAATCAAGCACACATGAAGTTTTTTATTGTAAACAGGGT


invisible?    
Gene introns: GPR158 (25464289 - 25891157)   Nearest EST:

Shown 1-30 from 120 sequences on 1 of 4 pages.
Pages:  1  2  3  4

Databases: ABC2_contigs // chromosome: chr10