Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr22

>19069 361 7624    22q11.21    chr22:18214815-18214455 BLAT!
TCTTTGTCTGTCCAGAGGCCAAGCAATGCTTCCAGGTATTCCCCTACTTCACTCCACAGC
CCCACCCTTATGATGGCATACACAGGGGAGAAGGGACGAACTCGAACAAACAGAAAAAGA
CCAAGAAATGCATCGTGGTGCTGTCTTCACCCCCCTCATTTAGCACTTTGTGATAACTGC
TGGGACAGATTGCCTAACCTTGTCTACAAGCAAAAATATTTAATCAAGAAAGCTAATGAA
AGCTCATCGGCAATGACTGTGAATTCTGTAACCACAAAGCATCTCACTCAATGTCTACAG
GGAAAACAGCTACATAATTGGAAGCTGAGACCAGTCCTGGACCTAACCCTCACTCTTGTT
T


invisible?    
Gene introns: 0   Nearest EST: BY797431 (18214430 - 18214687)

>26312 113 179    22q11.21    chr22:19622677-19622565 BLAT!
CTTTCCTAATTTCTTGCCATTCATTTTCAATTTTTTAAAAGTTTTAAGTTCAGAGAAATG
TATGTATGTTGTCACGTATCTTGTATCAGTTTCTTGTTTAAAGTTTGTTTGGA


invisible?    
Gene introns: 0   Nearest EST: 0

>31178 172 1045    22q11.21    chr22:19622721-19622892 BLAT!
AACAAGAAAGACAGGAGCAAATAGACAAGGGCCTAAGAGAAATAGAAGTTGAAAAGAAAG
AAAATCTTTGAGCATAAAGAAAAGAGAAACACGTAAAATCTCACTACAGACCAGCGCTAA
CAGAAGAACATTTCAACTTGATGACAGGGAACACTAGTTTTGAATCTTGATT


invisible?    
Gene introns: 0   Nearest EST: 0

>2 385 6878    22q11.22    chr22:23330794-23330431 BLAT!
AGGTACAACTAATCCGTGACAAATTACCAGATTAATTTTACTTTATTTCTTCAGGCCTGG
GGTTTTTCGATGACTTCAAATTTGGGATCTTCAAATTTGAAGGTGGGAAATGTATTCATG
TCTGCATTACCAAACATTTGCTTGAGCTTAAAAAGCTCCCTCTCCAGCTCTTGCTGATAC
TCTGAACTAGCATCAACAGGTCCTCCAGATGTCTGTCGCTTAGATTTGTATTCTCTAATC
TTGTCCACAAAGAGTTTCTGTATAGGATCAAGTTCCTTATTAAATGCCACTGCTGTAACA
CCAATGTTCCTCCGCAAATGGACTGAGACGGCTGACCGAATGACAGAGGAGAACCTGAAG
AGCCTCTGAAGAATCATGCTGATTC


invisible?    
Gene introns: 0   Nearest EST: 0

>8598 403 6877    22q11.22    chr22:23330794-23330431 BLAT!
GGTACAACTAATCCGTGACAAATTACCAGATTAATTTTACTTTATTTCTTCAGGCCTGGG
GTTTTTCGATGACTTCAAATTTGGGATCTTCAAATTTGAAGGTGGGAAATGTATTCATGT
CTGCATTACCAAACATTTGCTTGAGCTTAAAAAGCTCCCTCTCCAGCTCTTGCTGATACT
CTGAACTAGCATCAACAGGTCCTCCAGATGTCTGTCGCTTAGATTTGTATTCTCTAATCT
TGTCCACAAAGAGTTTCTGTATAGGATCAAGTTCCTTATTAAATGCCACTGCTGTAACAC
CAATGTTCCTCCGCAAATGGACTGAGACGGCTGACCGAATGACAGAGGAGAACCTGAAGA
GCCTCTGAAGAATCATGCTGATTCGGCCAAAGGTTAGTAGGTT


invisible?    
Gene introns: 0   Nearest EST: 0

>6696 207 828    22q12.1    chr22:27342247-27342041 BLAT!
TTATGTTTCTCCTATACATAAATACCTATAATAAAGTTTGTAAATTAGACACAGTAAGAA
GAGATTAACAACAGAACAATACTTAATAACAAAATAGAACAATTATAACAATATACTGTA
ATAAAAATAAAATAAGGTATTCTTTCAAAGCTAGCACTGTGATATCTCAACAGCCAATGT
GGTAACCAAGACAGCCACTAGTGGATA


invisible?    
Gene introns: 0   Nearest EST: 0

>26947 207 2099    22q12.1    chr22:27342580-27342786 BLAT!
GCCGCAGACACTGTTGGTGTCCTCACCCATATCCCTGCAGCCTTGCCTTTGTAGGGCTTG
CTGGGATGACTTCCAACAGTCTAAGGGCTTTGCTGTTGTCTGTGGCCTATTCTGCTTACC
TGCATGCAAGTTAGAAGTGCCTGAGAATTACCATCCTCCAGGAGCAACCTCAACTAAAGA
TTGACAGGAGTTGGTAAATAAATGGCT


invisible?    
Gene introns: 0   Nearest EST: 0

>24097 109 165    22q12.1    chr22:27389525-27389633 BLAT!
TGGAAGGTGGAGGCAGGTGAATAGCTTGAGCCCAGGAGTTTGACACCAGCCTGGGCAACA
TGGCAAGACCCTGCTTCTACAAAAAATGCAAAAATCAGCTGAGCATGAT


invisible?    
Gene introns: 0   Nearest EST: 0

>31130 117 466    22q12.1    chr22:28579723-28579607 BLAT!
AAAACTAGTATCATTATAATTTCAGGAGTCTAATAAAGCTGGTCTTGGATGGCTGCCAAA
CGAATGTGTCAAAGAACAGGAAAAAGGCAATGATAATGCTGAGCTTTTGACTGGAAG


invisible?    
Gene introns: TTC28 (28374001 - 29075853)   Nearest EST:

>8448 253 1985    22q12.1    chr22:28580200-28579948 BLAT!
ATTAAATACTTGCTATGTGTCAGACACAATTCTAAGCTCTTTAAATGTGTGGTCATAATA
AGCCCATAAGGTGGATATCATTACCCCCATTTTATAGATAAGGAAACAGAGACAGAGAGA
GTAACTTCCTTAATTAAGGGAAAGTAGCCAGTAGACACAGGATTCAAACCTAGGCAGTTT
TAATCACTGTATTACCTTATGGTTGCTAAGTCCATTATTATGCAGGGAACAGAATCAGTA
GTTGTTAGAAAAG


invisible?    
Gene introns: TTC28 (28374001 - 29075853)   Nearest EST:

>29976 103 264    22q12.1    chr22:28638180-28638235 BLAT!
GTCTACTCTCCAGCATTCCCCGGCCCTTTACTCCTTCTAATGGAGTGGGTGGTACAGATG
ACGGCTTTGTATATAATTTGGATGCACGTTCAGATAAGCCAAT


invisible?    
Gene introns: TTC28 (28374001 - 29075853)   Nearest EST:

>30831 114 210    22q12.1    chr22:28910578-28910465 BLAT!
TAGCTGCCAAGAGTGAACACTCCGTGTAAGGTTTTCTCTTCTTAATTCTCCAGCTTCCGG
CCTTTTGTTGGCTCTCAAAAGTAGTCTATTCAGAAGGCCTTATTCAGCATGTTC


invisible?    
Gene introns: TTC28 (28374001 - 29075853)   Nearest EST:

>4933 159 928    22q12.3    chr22:35140502-35140344 BLAT!
CATAGCTTTTATTAGGTTTCCAGAGGGGTCTATGACCTAGAAGAAGGTTAAGACCACTGC
TTTGAAAACACTAGATCTTCAAAGCTAACCCTGCTCTGTCTTTGAAGCTTTGCCCACCAT
GGTGGCTTTGAAGCTGAAAAGGCCATTCTCAAAGGTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>13047 140 279    22q12.3    chr22:35140719-35140858 BLAT!
ATTTCCCAGGTCTGCGTTCCATTCATCCATCCGTCTAGGTCTGATATTCAGTAAGTAGAT
TATGGTTTGGGTTGTATTTTTTCTTTTAGAAGCCAGCATCCATTCTGACTGGGAGGTGCC
CATGTCCCATAGGGTTATTT


invisible?    
Gene introns: 0   Nearest EST: 0

>10855 107 190    22q12.3    chr22:35244735-35244629 BLAT!
ATGTATCAATATTTCCTTTTATGGGTTATGCCTTTGATGTTATGTTTAAGAACTCTTAAC
CAAGCCCTAAATCCTGAAGATTTTCTTCCATGTCTTCTTCTCAGAGT


invisible?    
Gene introns: 0   Nearest EST: 0

>17904 119 484    22q12.3    chr22:35244747-35244865 BLAT!
AAAATAAAATAAAAAACATTTTCTCTGAGATAGACCTATTAAGGGGATAAAAAATAAGCT
GTGGAGTGGAAGAAAATATTTGCAAACTACGCATCTGACAAAAGACTATTATCAAGAAA


invisible?    
Gene introns: 0   Nearest EST: 0

>4033 129 242    22q12.3    chr22:35898125-35897997 BLAT!
TGCCTGGAACTCGTTAGCAACTGCGAGCAGAAGCTTTCCAGTCACACATCAAGGCGCTTG
ATCACAATGGAAAAGGTGAAGAAATTTGAGAATCGGGACCAGTATTCACATCTGCTAAGT
GATCATTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>18146 179 685    22q12.3    chr22:35898633-35898802 BLAT!
ACCAGGACGTCAAGGTAATACTTCTCTAAACCATATTGACGAAGATTGGCCCTAATGTTT
TCATCTGGTCCTCTCCACTTCTGGTTTTTCCTAGTAGCCTTTCCCAAGCCATGAACTGTG
TTGTAGTCTATGTCTGTCCCATACACATATGCACCAAAATGAGCACATGCTATCAGCAG


invisible?    
Gene introns: 0   Nearest EST: 0

>23886 207 585    22q13.2    chr22:41460383-41460177 BLAT!
GGCGTCTCTCTAAGAAATCCTCTATCTTCAGGCCCAGGATGTAATCCAGCTTCATCTTGC
CCTCATCCAGCACCCCAATGCGGACCAGCCGCCGCAGCAGGGCGTTGCCTTCGAACAGAC
GCCGTGGGTCCTTCTCATCAAGCGTCAGCAGTTCCCGGGCGGCCTTGCGGATCTTGGCCA
GGGTAAATTTGACCCTCCAGACCTCAC


invisible?    
Gene introns: 0   Nearest EST: AA554632 (41460172 - 41460233)

>530 119 639    22q13.2    chr22:43172589-43172703 BLAT!
CTCCTCCATCATGTCTGGAGTTACGCTGTTCTTTATGTATTGAGAGAACTGTTTCTTGTA
AGCATCTTCATCTTCTTCCATTAAGTAGCGCATGTAATCTGCAACATTCTGGCCCCCCC


invisible?    
Gene introns: 0   Nearest EST: AA102317 (43172413 - 43172642)

>6210 155 577    22q13.31    chr22:45894249-45894402 BLAT!
GACTCCTGGGTCAGAGACAGGGACTTTATTAGTTGCAGTAAAATAATAGCTGCAGTTTAA
GCATGGTGTTCACATGAGTTCCTTGTGTCTTCCAAGTCCTAGGGTCGGTGTGGAGTGGGC
GAGGTCAAGGGCCCATCATGGATGGTGGATGCCTT


invisible?    
Gene introns: 0   Nearest EST: 0

Databases: ABC2_contigs // chromosome: chr22