Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr4

Shown 1-30 from 284 sequences on 1 of 10 pages.
Pages:  1  2  3  4  5  6  7  8  9  10

>1335 176 881    4p16.3    chr4:2092353-2092178 BLAT!
TCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCTATAACTACGATGAAGATTTTGAA
GATGATGATCTCTACGGCCAGTCTGTAGAGGATGATTATTGTATTTCGCCGTCAACAGCT
GCTCAGTTTATTTATTCACGGCGTGACAAACCTTCCGTTGAGCCTGTGGAAGAATA


invisible?    
Gene introns: POLN (2073644 - 2230958)   Nearest EST:

>15679 178 867    4p16.3    chr4:2092376-2092199 BLAT!
AAGGGGCTGTGGCAAACGCCCTCTCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCT
ATAACTACGATGAAGATTTTGAAGATGATGATCTCTACGGCCAGTCTGTAGAGGATGATT
ATTGTATTTCGCCGTCAACAGCTGCTCAGTTTATTTATTCACGGCGTGACAAACCTTC


invisible?    
Gene introns: POLN (2073644 - 2230958)   Nearest EST:

>29092 275 775    4p16.1    chr4:8319670-8319500 BLAT!
AAAAAAAATTTTTTGTTGTTTGTTTTGAGAACGGGTCTCACTCCATCACCCAGGCTGGAG
TGCAGTGACACGATCACGGCTCACTGCAGACTTGACCTCCTGGGCTCAAGTGATCCTCCC
ACCTCAGCCTCCCGAGTAACTGGGACTACAGGCTCATGCTTAATTTTTAAATCTTTTTGT
AGAGACAAGATCTCCCTATATTATCCGGACTGGTCTCCAACTCCTGGGCTCAGGTGATCC
TCCCACCTCGGCCTCCCAAAGTGCTGGGATTACAG


invisible?    
Gene introns: 0   Nearest EST: 0

>13810 112 166    4p16.1    chr4:8988296-8988407 BLAT!
GCCGAGATCATGCCACTGCACTCCAGCCTGGGTGACAGAGAAAGACTCTGTCTCCAAAAC
AAGAAAATTAAACACGGTATGATTCCACTTATCTATCAAGTGTCTAGAGTAG


invisible?    
Gene introns: 0   Nearest EST: 0

>3378 145 278    4p16.1    chr4:11022035-11022179 BLAT!
GAGTGTGCTCGATATTAAGAGCACAGCAAAGAGAAAGGGACCTAGACTTAGACCTTGTCT
GAACCCATTAAAGTCTGGATGAGGAGACTTGATTCTGGGCAGGAATCATCTCTGGAGTTT
AAGGGGCAATAAAGCAAAACGCAGT


invisible?    
Gene introns: 0   Nearest EST: 0

>27401 111 385    4p16.1    chr4:11084983-11084873 BLAT!
AATAATTAAGACCGAGTTTTAGAATATTTTAAATCATGCACAAGCATATGTTTCCCTCTC
TTCTGCTATATCTGGAACACAATATGCAGTGGTTTGAGAGGCTGGGGCCTT


invisible?    
Gene introns: 0   Nearest EST: 0

>20057 168 343    4p16.1    chr4:11217087-11216920 BLAT!
TAATGAAATTAGTGCAATCATTTGCAGGGATAAGTAGTTAATTCTTAGCAACTGACAAAG
ACCAAATCCTTTATCCCTGATATTGTTTGGCTCTGTGTCCCCACCCAAATTTCATCTCAA
ATTGTAATCCCCATGTGTAGAGGGAGGGAACTGGTAGGAGGTGATTGG


invisible?    
Gene introns: 0   Nearest EST: 0

>10265 162 391    4p16.1    chr4:11217244-11217405 BLAT!
ATTTCATTCTGTCTACATGAAAGTGTGTGTGTATGAAGGTAGAAGGTGATTCAGGCTTAT
GATCTCGATGTGGACTATAATTTTCATAAAGCTTTTAAATTGTTTTATTTGAACTAAAGG
AAACACTGAGCTGAAACACATTTCTTTTATATTCAGTTATGG


invisible?    
Gene introns: 0   Nearest EST: 0

>27233 188 657    4p15.33    chr4:11306080-11305893 BLAT!
GTGGAATAGACTTGGGGAACACTGAAGTAATCATATGCTAATTCTCTCACTCCGTTGGTG
GATATACATACTAATCAATATGTTATACTTCACCAATTTAGAGTAATGGCATTTCCTGAA
CTGTGTTTAAGAGTCTTTGAGGGACTTTAAATTCTTCTTCCTCTGTTTCTTGCTTCCAGC
AATTTTGA


invisible?    
Gene introns: 0   Nearest EST: 0

>2124 165 1017    4p15.33    chr4:11306399-11306535 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGGAGTTGTCAGTTTTGGAGATACCTATGCAGC
CTGCAGCCATTTCTCTTCAAACAGATCTAAATGAGTGGGTGAATATAACCTCCACATTAG
TAACCATATTAGGCCATCCCTGACCCATAGGCAGTGCTTAGTTAG


invisible?    
Gene introns: 0   Nearest EST: 0

>11980 177 924    4p15.33    chr4:11306399-11306569 BLAT!
GCGGGGGGAGTTGTCAGTTTTGGAGATACCTATGCAGCCTGCAGCCATTTCTCTTCAAAC
AGATCTAAATGAGTGGGTGAATATAACCTCCACATTAGTAACCATATTAGGCCATCCCTG
ACCCATAGGCAGTGCTTAGTTAGATTAGTAGAAAGGGTCATATTCTTTTCCTTTCAA


invisible?    
Gene introns: 0   Nearest EST: 0

>11020 164 430    4p15.33    chr4:11310824-11310987 BLAT!
GAACCAGGTGGATAAATCTTATTAGACCCAAAAGGTAAGTATTATTGGCTCTATTTTACA
GGTAAAGTCATGGAAGAACAAGGGTTTTAGGTGATTTGCTCAAAATTCTTCAGCCCAAAG
AGCTCAAAGGAAGATTAAGAAGCCAAGTCTGTCTGAAGTCAGAA


invisible?    
Gene introns: 0   Nearest EST: 0

>10449 116 157    4p15.33    chr4:11431839-11431933 BLAT!
AGCGTGGTCGCGGCCGAGGTACTTTTGGAAAATAAGCTTTTAGGAGTTGAATGACCTTGT
CTACTTCTTTTAGTCAGAATAATGTTGGCATGTCTATTTTAGGTTAAAAAAAAATA


invisible?    
Gene introns: 0   Nearest EST: 0

>20056 209 493    4p15.33    chr4:11432212-11432004 BLAT!
AGCTCTTTAGAAAAAGTAATCATACCAACTTAGAGCATTAAAACCACCCCGTATTTTGAA
GGACTCATGATCTGCACTGTGCTTGGCTGCTGGTGGAAGCTTAAAGACACCAGTAATTGG
CAGAACTTTATCTTAGACTTCCATTTGACCCTCACAACCTCACACATGATTTTACACAGC
TTCCTATAATGGGGGAGAAAAGCCCTTCT


invisible?    
Gene introns: 0   Nearest EST: BX113183 (11432173 - 11432669)

>19014 225 639    4p15.33    chr4:11597133-11596971 BLAT!
ACCTGGAGTAATGGTTATCATTTATTTTTCCTTTTCTTCTTTATCATAATCATATCAACT
GAACCACACTTGCCATTCTGAAACACAGACTTTGTTCTGGAGAACAGGGAGGACATGCAG
AGCTGTTGTTTCAGATTCTTCAAACAGTCATTCAGACAAGATCTTAGTGCCACTTTGCTT
ATAAGTAAGCCGGTAACTGGCGGTGTTCTTCCAGTGAATGGTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>15544 214 793    4p15.33    chr4:11604297-11604510 BLAT!
GTAATGTTCAAAATAGGAGGATGACTAATAAGGTATTTATGATGCCTTTAGTAAGGTAAG
ACCCTTAGTAAGGTATTGATGATGTAAATACCTAGTGAGATGTTTACAATGCCCTTGCAT
GAATGTGGGATAAAAATCCAGCAGCTTCATGGTGAATCATCTTCAGAAAGTTTATGTTTA
GAGCTAACTTCAATTGTCCCATATATTGAAGGAC


invisible?    
Gene introns: 0   Nearest EST: 0

>14635 184 601    4p15.33    chr4:11604298-11604115 BLAT!
ACTAATTTCACCAATGAACAATTATTTCTAATATGTCATATTTGCCAATTAATCCAAATT
AATGGTTTCTTTTGGATAGCCTTTGATAATGATATCTGAAGCACTTATAGACAACCACTA
TGGGCTGTTGGTTTCTGATTCAGCACTTCCTATGCAATTTAACTGCCACCAAATTGTAGA
TTAA


invisible?    
Gene introns: 0   Nearest EST: 0

>28892 192 575    4p15.33    chr4:11604932-11604741 BLAT!
TTCTGAAGCCTATAAACCCAAAACGAGTGTCATGTGAGAAGACTTTGACTAGTGTCATAT
AAATGCCTGACAGAAATTTCGAATAGACGTCACAAACTGTCGATTCAGCCATTGTCATGA
TTTTTAAATAAATATTGGTAACCTCCTACGGTTAGAGATAGAAGAGGATATACATCCTCT
CCCTAACAATTT


invisible?    
Gene introns: 0   Nearest EST: 0

>6980 109 185    4p15.33    chr4:11605207-11605315 BLAT!
CATATATACACACACACACACACATACACACACACAGAGAGAGAAAGAGAGAGAGAAAGC
AATAATTATCCCCAAATTTAATATTTTTTGTCTGTAAGCGATAGTTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>27797 173 576    4p15.33    chr4:11884787-11884959 BLAT!
TTTTTAACATTCTCTCTCATATACTTTACTGTAATTACATCTAAACTACTTGTCACTCCC
CCAAATATACCATATTACTTTTAGCTTCTGCAACTATATATGTGATAATCCTGTCATTTC
CCCTTCGTTTCTCTTTAAAGGAAAATCATCAGCATTTATTGAGGGCCCATACT


invisible?    
Gene introns: 0   Nearest EST: 0

>10571 100 164    4p15.33    chr4:12056254-12056155 BLAT!
GGATGTCATTGTAAGAAGAGACGACCTACTGTGTGCAGTGTTGGAGACTATACAGGGGAA
TGAGGCTGTCTGCAAGGGGTGAGAGAATCTAGCAGGGGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>32531 101 228    4p15.33    chr4:12056594-12056694 BLAT!
TGTTATTATTATTAATTACCTAATGTTCTCTTTTCTGATATAAAAATCTGGTTTTAGAGA
TCAATTTGTCAATTATGTCTCAATGTGAGCTTAATTAATCC


invisible?    
Gene introns: 0   Nearest EST: 0

>31369 154 733    4p15.33    chr4:12350326-12350173 BLAT!
CCATTCATAGTAAGTTTACCCATCAGGAAACAGCTTCTCCAGAGTTCCGATTAATGTTTC
CTGGTAAACTTATAAGGAAAGGGATGGTAGGACAAACTAGAGCTGTTCATGTTGTAGTTG
ATCACAAGGCTGTAACTGATTCATCCTCCGCCTC


invisible?    
Gene introns: 0   Nearest EST: 0

>21652 156 325    4p15.33    chr4:12350743-12350898 BLAT!
AAGTCAACTGACTATGAGAATATACAGAATAAGAAGATATATATTCGTTTTCCCTTTATG
TATTTCAAATCAGGTTTTTAAATTAATGTAATGTTTTATAAAACCTTAATTTATATATAT
TGTTAAAAAAGAAGCCAGTCTTTATTGTTCTTCAAT


invisible?    
Gene introns: 0   Nearest EST: 0

>28484 105 220    4p15.33    chr4:12471464-12471360 BLAT!
GCAGGTGGATCACTTGAGGTGAGGAGTTCGAGATCAGCCTGGCCAATATGGTAAAACCCG
TCTCTACTAGAAATACAAAAAATTATCTGAGCATGGTGGTGTGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>28064 169 430    4p15.33    chr4:12577648-12577816 BLAT!
AGAAGAGATGAAAGACACAACAAAACAAAAATCAACTTTAGAAAAAAGAAAAACCAGGAC
TAAGAGAAGAGAAGAAACACAAGCTAGAAAGAAGTGATAGATATTAACTAAAATTTGGCA
AGTAATTAGTAGGACACTTGGGCCAGGAGGGTAGAGAAAGAAAAAAATA


invisible?    
Gene introns: 0   Nearest EST: 0

>23380 107 198    4p15.33    chr4:12727539-12727433 BLAT!
AGAGAATGCAAACTCATAGGCAACCTGTCACTTATGTTGATTTTGTCCCTGGTGTATAAT
TAGGCTCCCTGCATCTGATGCCACTCCCCTTGTTTCTCTGCCTCCCT


invisible?    
Gene introns: 0   Nearest EST: 0

>15008 112 153    4p15.33    chr4:12786375-12786486 BLAT!
TTCCTTTGGTGGTCCACTTGGACTGCAGCCATGAGTCTCTGGTGCCCATTTGTCTCACAT
TATGAACTGATGTGCTCCATAAACCACCCATAATATGCTGGAATATGGCTCC


invisible?    
Gene introns: 0   Nearest EST: 0

>13353 208 2057    4p15.32    chr4:16972179-16971968 BLAT!
ATGTAAATAAAATAAATATAATTATGGTAAATCTTAAAAAGTGTGTGCAATTCATGAGTT
TTGGCAGTGGCATACACCCACAAAAGTGCCACCACAATCAGGATTCAGAACATGTTTATC
ATCCCTCAGAAATCCTCAAGCCCCTTTTCAGTTGATTCTGCCCCACTCTCTCCCTCCTCG
GGCCTCAGGCAAACACTGAACTGCTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>16286 148 269    4p15.31    chr4:18517750-18517603 BLAT!
ACAGGGTTTCACCATGTTGGCCAGGCTGGTCTTAAACTCCTGACCTCAAGTGATCCACCT
GTCTTAGCCTCCCAAAGTGCTGATATTACACGTGTGAGCCACCACTTCCAGGGTCTACCT
TACATTATATGTAGTATGAATGGAAACA


invisible?    
Gene introns: 0   Nearest EST: 0

Shown 1-30 from 284 sequences on 1 of 10 pages.
Pages:  1  2  3  4  5  6  7  8  9  10

Databases: ABC2_contigs // chromosome: chr4