Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr9

Shown 1-30 from 129 sequences on 1 of 5 pages.
Pages:  1  2  3  4  5

>29180 118 436    9p24.3    chr9:1972428-1972311 BLAT!
TTAGGCAGTGCCTCAGTGGAAACTCTGTGTGGGGACTCTGACTCCACATTTCCCTTTTGC
ACTGCCCTAACAGAGGTTCTCCATGAAGACCCCACTTCTGTAGCAAACTTCTGCCTGG


invisible?    
Gene introns: 0   Nearest EST: 0

>31510 102 803    9p24.2    chr9:2255862-2255927 BLAT!
AGCGGCCGCCCGGGCAGGTCGGGCAGGTACGCGGGGGACCACCATAACTTAAAGCCAAAG
GGTTCAAGAACCTGTTGATATGATTCATCCAGGTCAGAAGTG


invisible?    
Gene introns: 0   Nearest EST: 0

>13390 119 379    9p24.2    chr9:2452221-2452103 BLAT!
AGAAAACTACTTTCTCTCTTCTGGAAGTATTTGGATTCGGATTATATAAAGATGAGATGA
TGCAAACTCTCAGACTCTCCCTTCATGGGGCACAGGAGCATCTAAACAAATCAAGATTC


invisible?    
Gene introns: 0   Nearest EST: 0

>17551 182 402    9p24.2    chr9:2490460-2490279 BLAT!
GACCCCTTTTCTAATAAATACCCTCGCCTTCTCCACTTCCCCTGAGCCTAGATCACTGCT
TCTTCTCAGACTCTAGTCCCTCCCTTCAATTTGTCCTGCTTGTATTTCATCTTCTTTAAT
CACTGGTTTCATCACATCACTCCCATGCTCAGAAACCCTTAAGGGATTTTTATTTCCCAC
CA


invisible?    
Gene introns: 0   Nearest EST: 0

>4750 100 167    9p24.2    chr9:2491612-2491711 BLAT!
TTCAACTTGTCAGTGAAGATGCATCACTGGGTCATAAAACCCTTTCCTAAATTAAAATGG
TGTATGAAATAGTCCAGGTTAAACTGAATTAGAGGTTAAG


invisible?    
Gene introns: 0   Nearest EST: 0

>14392 194 347    9p24.2    chr9:2875798-2875991 BLAT!
GCTGCTGACTAGGACTATAAGCTGGCTGTGTGGGCCCATAGTGAGGTGGGGGCTGAGCAG
TCCCATAGGCACCACCAGGACTGCCTTGGAATTGTCCATGCTCTGGTGTCCCTGCAAAAG
CAGCTGCTGAGCCCACGTAGTGCCGGGTCGTAAGCACTTGGGGTCCAAACATTTGTTTGG
CTCTGTCAGCTGCC


invisible?    
Gene introns: 0   Nearest EST: 0

>8421 103 253    9p24.2    chr9:4365368-4365266 BLAT!
GGCCAGGCTAGTCTCAAACTCCTGACCTCATGATCCACCTGACTCAGCCTCCCAAAGTGA
TTACAGGCATGAGCCACCGCACCCAGCCTGATTTGATCTTTCT


invisible?    
Gene introns: 0   Nearest EST: 0

>19330 171 266    9p24.1    chr9:5215164-5214994 BLAT!
AGTTATTTGTAGATTCTGGATATTAGTCCTTTGTCAGATGGATAGATTGCAAAAGTTTTC
TACCATTCTGTAGGTTGCCTGTTCACTCTGATGATAGTTTATTTTGCTGTGCAGAAGCTC
TTTAGTTTAATGAGATCCCATTTGTCAATTTTGGCTTTTGTTGCCATTGCT


invisible?    
Gene introns: 0   Nearest EST: 0

>27476 118 387    9p24.1    chr9:7597225-7597108 BLAT!
TACAGGCACGCACCACTACGCCAGGCTAATTTTTGTATTTTTAGTAGAACCGGAGTTTTA
CCATGTTGCAGGCTGGTCTCGGACTCCTGACCTCGTAATCCACCCACCTTGGACTCCC


invisible?    
Gene introns: 0   Nearest EST: 0

>30322 100 273    9p24.1    chr9:8006505-8006406 BLAT!
CAGCCACTGCAAAAACATACCAAATTGTAAAGACCATTGACGAGGAAGAAATTCCATCAA
TTTATGGGCAAAATAACCAGCTAACATCAAAATGACAGGA


invisible?    
Gene introns: 0   Nearest EST: 0

>13686 117 172    9p23    chr9:11017282-11017166 BLAT!
GATGAATTAATGGGAAGTAATATTTAATCCCCTATAAGAAAATAAGGAAACAAAATAATT
GTTAAGTGCAGTTACAACAAAAAATATATAAAAATAGAAAACAGAGAAGAGTGAGGC


invisible?    
Gene introns: 0   Nearest EST: 0

>2431 654 5915    9p23    chr9:12972792-12973420 BLAT!
AAAAAAAAATACAGAAGAGGTTTTGTTCTCATGGCTGCCCACCGCAGCCTGGCACTAAAA
CAGCCCAGCGCTCACTTCTGCTTGGAGAAATATTCTTTGCTCTTTTGGACATCAGGCTTG
ATGGTATCACTGCCAGGTTTCCAGCCAGCTGGGCACACTTCCCCATGTTTGTCAGTGAAC
TGGAAGGCCTGAACTAGTCTCAAAGTCTCATCCACAGAGCGGCCAACAGGGAGGTCATTT
ACAGTGATCTGCCGAAGAATACCCTTATCATCAATGATAAAAAGGCCCCTGAACGAGATG
CCTTCATCAGCCTTTAAGACCCCATAATCCTGAGCAATGGTGCGCTTCGGGTCTGATACC
AAAGGAATGTTCATGGGTCCCAGTCCTCCTTGTTTCTTAGGTGTATTGACCCATGCTAGA
TGACAGAAGTGAGAATCCACAGAAGCACCAATCACTTGGCAGTTGAGTTTCTTAAATTCT
TCTGCCCTATCACTGAAAGCAATGATCTCCGTGGGGCACACAAAGGTGAAGTCAAGAGGG
TAAAAGAAGAACACAACATATTTTCCTTTGTAGTCAGACAGGCTGATATCTTTAAACTGA
CCATCTGGCATAACAGCTGTGGCTTTGAAGTTGGGGGCAGGGTGCCCAATTTTA


invisible?    
Gene introns: 0   Nearest EST: BE763416 (12972943 - 12973043)

>13969 231 981    9p22.3    chr9:14921557-14921749 BLAT!
AAATCTGCTACAGAGAGTCCAATAGCCCAGGATGTGTAGCCTTTGAGTTTGATCACCTCA
TAAGCACTCTCAACCACCTGCTTGTGAACCTCTTTCCACTGTTCCTTATCTTTATCAGTC
CCTAAATCTGGGTGCAGAGTCTTCAGAGAGACACCAGCAACATTCATTCCACTCCATACA
GGCACACTGGAATCTCCCTTCAATTTGTCTTCGATGACATCAACAAGAGCA


invisible?    
Gene introns: 0   Nearest EST: CD048490 (14921721 - 14921989)

>16509 323 1289    9p22.3    chr9:14921748-14922070 BLAT!
ATCTCCATGTTCCCCAAGGACCCACCCATGACAGCTTAATGGGTGAACTCCCAGCCTTTC
CCCCATTAGGTAACGGAATCGGGCTGAATCCAGATTGCAACCGCTTCCAATAACACGGTT
TTTGGGAAAACCACTTATCTTCCAAGCCACGTAGGTCAAGATATCCACTGGATTTGAAAC
AATAAGCAACTTGCAGTTCGGGCTGTATTTTACAACATTAGGAATGATGAATTTAAAGAT
GTTCACGTTACGCTGGACCAAATTAAGACGGCTTTCTCCCTCTTGCTGACGTGCCCCAGC
CGTGATAATGACCAGCTTGGAGT


invisible?    
Gene introns: 0   Nearest EST: BF821188 (14921929 - 14922041)

>2175 168 621    9p22.3    chr9:14922151-14922318 BLAT!
TCTCCCTTCAATTTGTCTTCGATGACATCAACAAGAGCAAGTTCATCTGCCAAGTCCTTC
ATTAAGATACTGATGGCACAGGCCATGCCAACAGCACCAACCCCAACAACTGTAATCTTA
TTCTGGGGGGTCTGTTCTTCCTTTAGAAGATTATAAATCAGCTGATCC


invisible?    
Gene introns: 0   Nearest EST: 0

>14480 364 1438    9p22.3    chr9:15055615-15055272 BLAT!
TTGACTTCTGTAGCTGCAGGTCGTCCTCTTTTAGGACTCACTTTTAGATTAACAGATGCT
GTTGCTGTTGTCACTACTCCTGCCTCCTCAGTTTCTACTTGTTTTTCTGCCTTTCTCTTT
CTCCCCCTTCTGGCAGCTTTTGGAGTAGTTATGTCAACTGCTTTAGTCACATCCTCATTG
CTGGCTTTTTCTTCATGGTCGGTATCTTCCTTTGAAACACTAGTTTCCTTTTCTTCAACT
TCAACATCAGATGATGCATTTGATTGTTTAGTTGCTGCCTGTTGACTTGAAAATTTCACT
TTTGGATTGTTATCTATCTCCCATAAACCTTCATTAAAACCTTTTCTTTTATTTGGTTTG
CCAT


invisible?    
Gene introns: 0   Nearest EST: AI611428 (15055607 - 15055698)

>1244 206 708    9p22.3    chr9:15055874-15056025 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGAAGAAGAAGGAGATGATCAAGAAGGTGAAAA
GAAGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAGAAGGAATATGCTGAAAGGCCA
ACATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCA
GCAGAATAAAGATGAAGGAAAGAAGC


invisible?    
Gene introns: 0   Nearest EST: BF801023 (15055939 - 15056001)

>32611 209 689    9p22.3    chr9:15055874-15056025 BLAT!
GCGGCCGCCCGGGCAGGTACGCGGGGGAAGAAGAAGGAGATGATCAAGAAGGTGAAAAGA
AGAGAAAAGGTGGGAGGAACTTTCAGACTGCTCACAGAAGGAATATGCTGAAAGGCCAAC
ATGAGAAAGAAGCAGCAGATCGAAAACGCAAGCAAGAGGAACAAATGGAAACTGAGCAGC
AGAATAAAGATGAAGGAAAGAAGCCAGAA


invisible?    
Gene introns: 0   Nearest EST: BF801023 (15055939 - 15056001)

>4632 172 505    9p22.3    chr9:15150490-15150319 BLAT!
ATCACTTTGTCCCAGCCACACTCACCTTCTCCCTATTCCTGCCAACTGGGCTCACCTCAT
AGCCTTTGCACTCATCCTTTGCTGTGCCTGGAGTTGACTTCCCTCAAGTCTTTGCTTGAT
TCACTTCTTCTCATCAGTTGAGTCCAGCTGTCACCCCCTCAGAGGCTAGATT


invisible?    
Gene introns: 0   Nearest EST: 0

>31252 234 1306    9p22.3    chr9:15151038-15151271 BLAT!
AAGTGTTGTGGGACGGGCATTTCCAATACCAAGGAAGGTGCCAGGAGTCACCAAACCACC
CACAAATCTTAAGGGGATTGCCGTGGCCTCTTAGTCACCCAGCCGGAAGCTGCTATCTTC
CTGGCAGGAATTGCCTCCCCCTCTACCCCTGCTATTGTGCCAGATGTTCAGGTTGCCTGA
ATACGTCTGCCCTGGTGGATTACTTCAGGCACCCCTGCCCAAGAACATTCATGG


invisible?    
Gene introns: 0   Nearest EST: 0

>20983 134 263    9p22.3    chr9:16198023-16198156 BLAT!
AAATATACAAAGTCCTAATGGCTAATCTATTCTTCTAAGTATGTGGAAGGCTACTACACC
GAAGAGACTTGATCTAATTGTATAATAAAACTCAAATCATTTCCAGCCAGATCGGACATG
CCAGGGCTGCTGCT


invisible?    
Gene introns: 0   Nearest EST: 0

>6967 171 363    9p22.2    chr9:18147873-18147703 BLAT!
TGCAACTGTAGAGAATAGTGGAATACACTGTTCTTGCAAAATATAATGACGTGCTCTGAA
CTGTAAACCACCTATGTTCATTTTCATGCCTACTTATGTGGAACCCTGAAGCTCAATCAA
TGGAATGGAACAGCCTCTAGATAACAGTTTCTACAGTTGCTTTGGTCTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>1975 919 31268    9p22.1    chr9:19454159-19455032 BLAT!
AGGTACGCGGGGGATTACATCATTATAAATCAAGTCCTTCCATGAACACATTTAAGGTGT
GTGGAGATGAGATGTCTGAATCCATTTGGGGATGGGCTGCATTTTTGGGGAACTCTATGC
CTGTCCAGTGAAGAGTGCCTAAAACATTAATTATAGATCAAAGATGTTCTGTTGAGGGAC
AAAGCTTGATGGTCATCAAACACAAGGCTTTGTAAAAATACGACCACCTATTCCACTTAC
TGGATCTGTCAGGTGTGTAAAACTTCTCTCGCCAGTTCATCATGCTTCCATGAGCCCTCA
GGACTGGGATTTGAGCCTTCCTGGCTCTTTATCCCTTGGGGCAGACATGGAACCATCTCT
GAGGGACCAGGTGGATGCTGAAGCTCACCCAGTCAGGGCCCCTCTCCTAGCTCCTTTTAC
ACTGAAATTAATCTGAAAGCTTTCATAGCCAAGGCTTTGCCTAGGTGCTATTATTCCAGC
TGGCCAAAGAGAAGTCTTGGGCCAGATTGGGATTCTCAATGGATTTTATAGACATAATTC
CCCTGCAAACTTAAAAAAATAAATAACCCCTACTTTATAGGACTAATTGTTTGAATTGTA
TCTTTCTCTGTATGTTAAACCAGATTTAAAACTATTTTATAACCACAATATGTAATCAGA
GCAATATAGTGTTTTCAGATATATACCTTGTTTTATACCTTATGTAGGTGTCCTACATAA
GGGTGGCATGCCCACTGGCTGTGGTAAAATTTAATCCTCATTGCTTTGGGAGTGACTTAA
GGCCTTTTGAAGTGGAGCTTTTGCACTTTATACTTTTTCTGTGAACTATGATAACTATAT
TTGATATTAAAGCTGTAAGTGGCATTTTCAGCAAATGAATATGTACCTGCCCGGGCGGCC
GCTCAAAGATCGGAAGAGC


invisible?    
Gene introns: 0   Nearest EST: AA481584 (19454175 - 19454595)

>24468 122 183    9p21.3    chr9:21395497-21395618 BLAT!
AATTCTCCAATGAAAACCATGACTATACAGCATATAAAGCTGAATGCTTCATAGAAAGCC
CTTGCTTAAAACAACTAGGATTTAAAAGTTCCTATAAGTGGAAATTAAGGAAGACAGTTA
TT


invisible?    
Gene introns: 0   Nearest EST: BI561342 (21395617 - 21396338)

>3838 193 686    9p21.3    chr9:21395521-21395329 BLAT!
TAGTCATGGTTTTCATTGGAGAATTTTATTAACATTTTCCACTTGGTTCAAAATGTCATC
CCACATAGATAAGTTGCATAAAAATGTGTAATCTCTTTGCATTAAGATGCTTTCCATTTC
AGCATAATGCAGGTTTGCATTTGGTATCATTTACTGCTTAATACATATCTTAAGTGCCAA
TACATCGATTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>22992 102 163    9p21.3    chr9:21933398-21933499 BLAT!
ATGGAGAAGGAGTTTAAGTAACAAACCTTACCTTTGTTTAAGGTGCTTTTTCTGGCTCTC
TGCCATTAAGATCTACATTTTCCACCCTGTCTCCTCTAGGAC


invisible?    
Gene introns: 0   Nearest EST: 0

>12750 124 289    9p21.3    chr9:21933476-21933599 BLAT!
TTTCCACCCTGTCTCCTCTAGGACCTGAGGGTTATCTCTTTGATATGCAAATGCCAGGGA
GATTACTCACCAGAAGAAGAAGAAGAAATAGAGCTAATTGGAAATTGAGCAAATAAAAAA
ATCT


invisible?    
Gene introns: 0   Nearest EST: 0

>30052 110 173    9p21.3    chr9:23365256-23365147 BLAT!
AAAGATCCTTTGTATTTCTAGTTTATGTAGTTTTTAATCCTAAAGGAGTATTTGATTTTT
TTCAAATAATGTTTTGTGTCCATTGAAATGATTCTATATTTTTGACTTTT


invisible?    
Gene introns: 0   Nearest EST: 0

>19371 110 170    9p21.3    chr9:24448951-24448842 BLAT!
TACACTCAGAGGAACTGGTCTCCTCAACCCAAGCAAAAGCAGCATCCCCATCCTCAGTGG
AAGTGACATACTCACCTCCAGTGGTATCATCCTCTTCATTCACAGTGGCA


invisible?    
Gene introns: 0   Nearest EST: 0

>21192 138 244    9p21.3    chr9:24924216-24924353 BLAT!
CAAAAAGAAGGAAAACAAGTTTTTTACCTGTTCTATAGCTGAGCCACACTCCATCTTCTG
CCTTTGCACATTAGAACTTCAGATTCTCTGGCTTTTGGACTCTCAAACTTGCACCAATAT
GCCCTTAGGTTCTCAGGC


invisible?    
Gene introns: 0   Nearest EST: 0

Shown 1-30 from 129 sequences on 1 of 5 pages.
Pages:  1  2  3  4  5

Databases: ABC2_contigs // chromosome: chr9