Postparser v2.3 // project Bladder

Databases: ABC2_contigs // chromosome: chr4 (only within introns)

Shown 1-30 from 56 sequences on 1 of 2 pages.
Pages:  1  2

>1335 176 881     4p16.3    chr4:2092353-2092178 BLAT!
TCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCTATAACTACGATGAAGATTTTGAA
GATGATGATCTCTACGGCCAGTCTGTAGAGGATGATTATTGTATTTCGCCGTCAACAGCT
GCTCAGTTTATTTATTCACGGCGTGACAAACCTTCCGTTGAGCCTGTGGAAGAATA


invisible?    
Gene introns: POLN (2073644 - 2230958)  

>15679 178 867     4p16.3    chr4:2092376-2092199 BLAT!
AAGGGGCTGTGGCAAACGCCCTCTCCGCCGTCATGGCCCGGCATCGGAATGTTCGAGGCT
ATAACTACGATGAAGATTTTGAAGATGATGATCTCTACGGCCAGTCTGTAGAGGATGATT
ATTGTATTTCGCCGTCAACAGCTGCTCAGTTTATTTATTCACGGCGTGACAAACCTTC


invisible?    
Gene introns: POLN (2073644 - 2230958)  

>11418 309 2627     4q21.1    chr4:77266748-77266440 BLAT!
GCATATCAGTTATTCTTGAACAAGTCAATACAGCTCTGCAAAGGGGAGACATTGTTCCTG
GCATGTTTTATTTCCAGTTCAGACATTTCAATTAGATTCTTTCTAAATGCTGCCACTCTC
TTCCGTTTGAAATTTATCAGTTCTTCTTTTGCAGATTCGGAAAGTTGTTCAAATTTCTGG
CAGCACTCCTGCTGGTGTGCCTCAGCCAACTTGACGTCTTTGCTCTTTAACCGGGCCTTA
TCCAGAGCTTTGTTTGAGTTCTCATAGTCAATGAGGGCTTTGGTGCGTCTGTATAAGAGA
TCCTTAGCA


invisible?    
Gene introns: CCDC158 (77234191 - 77328458)  

>24855 167 548     4q22.1    chr4:91390577-91390411 BLAT!
AAGACTATATGAAGAGCAGTTAAATTAACTGACTTTTAGATTGTATTAAAACTGAATTAA
AATCATTATTTTCTAAATTGGTCAGTGTTTCTTCCCTCTATAATAAGAATATTAATACTG
AATATCTTCATGCAATCAAATATATACATTGCCCTATTCACAAACAG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>24892 231 3051     4q22.1    chr4:91391344-91391574 BLAT!
TATCAATTACTTGATTAATGTCTCCATTATATTTTCTTATTTCAGCAGACCTGGAAGGTA
TATATATCCCATATTTTAAATATCTCCTAAAATATATCTTCAGTTGTAATCTTAATGATG
CCATCTATCAAATGGAAATTGTTTATGTCCTACATACCCAACACTGTTATTTTGAGAATT
AAAAGATAGGTGTGAACATATGGCAAGAACAGAGTATAAATGCAAGCACAG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>6752 246 1006     4q22.1    chr4:91432377-91432132 BLAT!
AGGATGGTCTCAATCTCCTGACCTCATGATCTGCCTGCCGTGGCCTCCCAAAGTGGTGAG
ATTACAGGCATGAGCCACTGCACCCAGACTGATTTCTAGCTTCATCTTACTCTATCTCTC
AGTAACATTTGAGTTGGTTGATTACTCCCTTGTGGTAGAAACACTTTCCTGCTAACAGTT
TCCAATTCCATCTCATTGGCAACTCCCTTCCAGTCTCTTTGCTGGTTTTTCCTCATCTCC
CTAATC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>1220 203 961     4q22.1    chr4:91432381-91432179 BLAT!
GGCCAGGATGGTCTCAATCTCCTGACCTCATGATCTGCCTGCCGTGGCCTCCCAAAGTGG
TGAGATTACAGGCATGAGCCACTGCACCCAGACTGATTTCTAGCTTCATCTTACTCTATC
TCTCAGTAACATTTGAGTTGGTTGATTACTCCCTTGTGGTAGAAACACTTTCCTGCTAAC
AGTTTCCAATTCCATCTCATTGG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>26145 324 1392     4q22.1    chr4:91432520-91432816 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGATTGCACCACTGCACTCCAACCTGGTGATAGA
GCAAGACTCCATCTCAAAAAAAGAAAGAAGATAAAAATCCTTGGTAACTTCAACACAGCT
TTACGTTGGTGAAGATTCAAGTGCTATTCGAATGAGTTCAGAGACAATAGACTAAAAGGA
GTTAGAGTTGGTGCATATAGGAAACCCTCAACCAGTTTTGTTGTAAAGTGGAATAGATAA
ATGAGGCAGTATCTTGAGAGATAATTCAGGTTCAGGAATTTTTCTAAAGATAGGTGATAT
AGAGCTCCTGTTTGGATGCTCTGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>14031 247 3640     4q22.1    chr4:91432805-91433051 BLAT!
TGGATGCTCTGCAGATAATAAAAGATGAAAGATTTATACAATCTGAGGAGAAAGCAGAGT
ATGTGCTTCAAGTAATAACGTGTAAAGAGAACAAAATGATGGTATGGGAGGCAGAAAGAA
AATAATTGATGAGAGAGGAATTTCTCAAATAGGTATAAGGGGAGGTAATCTAGTTAACCT
TTAGAGGGGATGGCTTAACCACAAAGAACCCAGACAAAGAGGTAAGCAAATATATGATAA
CATCCTT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>3772 211 1843     4q22.1    chr4:91433422-91433212 BLAT!
GGCACCATAGTAGAACCCAGAAAAGGAGTGGGGTATGGAGTAGAGACAGTGAAAGGAGAG
GTGGGAAAGAAAAGCCTATATTGCATCTCCATTCTCAGGCAGATCAGTTTTAGAGATGAC
ATCATGAAGAAGAGGATTTTGAAAGTGAACTTTAAAAAATGATCTGTGACCACATATCTA
CGGAAAAATATGTATGTTGCCCAGTTTGCCG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>17221 214 571     4q22.1    chr4:91476001-91475788 BLAT!
AAAAAGATCAGTAGCATAAACAGCATTACATTTTACTTCTCAGATATCTCCCTTAAAAAC
GAGGTATGATGAGAAGTCAAATCTGTTAGCTACTGGGCTAAGAAAAGTAAAACAGCATTC
ACTTACAGAAAGATAAGTTCCCTTACACACTGGCATGCATTTAAAGACTTCCTTAAAATT
TGGATATTCTCCGTTATACTTTAGCTCCTGTCCT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>9145 141 254     4q22.1    chr4:91946985-91947125 BLAT!
GTGTATGTGTGTGTTTGGTTTTGATTTTGTCTGCTTGTTTATTTTTAATTCACAAGCTTT
CATTTTCCTGGGAACACAGCCTAAACTCACTGAGGATTGGGCTAGATGAAGAGGGATGAA
CAATCTGAATAACAAACACAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>25931 162 468     4q22.1    chr4:91953214-91953376 BLAT!
CTAGAACAGTATTTGTTAAAGAACAATTGTCTAGAAAGGAAAAAAAAATGTGATTTTTTG
CATAACTCTGCATATTGTTTTAATAATATACTTCCATTAGTTCTCTTGCCTTTATATTAC
TTACATGTTATACATTTCTTCAAATAATTTTACTGTGGGGGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>8296 431 4140     4q22.1    chr4:91954129-91953699 BLAT!
TAAATATTATTTGACACCATTCCCAGGGAGGTGGAAGGAACTACCAAAGAAGTCTTGCTC
TAGATCAGTAGTTCACCAAGTGTGGTCCCAAGCTACCTACACTGGCATCATCTGGAAACC
AGTTAGAAAAGCAAATTCTCAGGCCCCATTCAAGACTTACTGAATCAGAAACTCTGGGGT
TGGGCCCAAGTAATCTATATTTTAAAATGCCTTCCAGGCAATTCTGCTGCATATTAAAGT
CTTAGAAACTACAACTCTTAATAACAATTAAGAAATATAATCCCTATTCCCCATAAAGTA
AAAATCTTCAGTATCTCCCTATTTCCTGCAATCAAATCCAGTTATTACTTTAAACATTCA
GCAGTTGACTCTACTTAACTTCTTGGTCAGTGTTCCTTCCTATCTATCAAAATCCTATTT
GTTAATTGAAG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>2533 145 292     4q22.1    chr4:91966229-91966085 BLAT!
TATATGTATAAGATACAACCCTCTGTCTCCCCTGCCTACAACCTAGGCATGTCCAATAAA
GAGTAATATAATACATGCTACAGATCAAGAGGTAGAGCCAATAAGTTCTTTTCTGAGCAA
GATACTAAAGATTACAAAACAGACA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>32145 139 267     4q22.1    chr4:91967973-91968111 BLAT!
ATTCCCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGATGTAAACAAACATGCCCAGC
TAATTTTTTGTATTTTAGTAGAGACAGGCTTTCAGCATGTTGGCCAAGATGGTCTCGATC
TCCTGATCATGTGATCTAC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>12107 184 783     4q22.1    chr4:92054718-92054535 BLAT!
ATCAAAAATCAAAAGTTTATACCAATGCCTCTAAGTCCAGTTCAATACCAGAGGCGTCAA
TCTACCTTCACTACTTCCATATTTTAAAATTTCTTCTCTAACAGGGAGTAATCAGATGCC
CATTATGGTAAATATATTTACTCATTCGCTGACTTCCTATGTGATCAATATCTGACTTCA
TGAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>29535 165 1021     4q22.1    chr4:92141045-92141209 BLAT!
TAGATAGAAATTTCTATGTAGAGTATTTCCCATACTTTCATTTGACCAGTGTTTTTAGAA
CCTCTCTTAAAATGTAAATTTACTCAAAACGTCATATATAAATCAGTTAAACCTAGAGTT
CTTCTAGTTCAAGTGAGAATGGGAGATCCACAGTTTATCCCTTTT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>25628 249 4885     4q22.1    chr4:92141388-92141636 BLAT!
TGTCATAAATTGAGAAGAAGTTTTTGTTTTGTTATTCTAGTAAGAATTGCCCCTGGAAAT
GTATGCTCGTTTCTTGCATGCTGCTGTGCTCGTTGAAAAGGTGGCAATGACCTGACAGAT
GGGACAAGGAATTTATTTTGCCTGAACAATCATATAGTTAATGGAACATTTAAAAATTGA
CTTTTTATGATTATGTGATTAACAGGAATAATTCCTTTAAATACACTGTTTGCTAAGAGC
TAGAATACA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>24336 161 578     4q22.1    chr4:92143064-92142905 BLAT!
TCGGACAATATGTTTTTGCCATAATTTGCTCTTATAAGTAATTATCCATAGTATACCCCA
TTTTTCTGAGCATAACCTTATCACACTGGACTCTAGCTATTTATTAATGGACTGTTTCCA
GCATTAGAGCATATATATGAGTGCCGGGACTGTGTACAACA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>13257 232 1684     4q22.1    chr4:92143624-92143855 BLAT!
ATTCCTCATACTATACCTTTTGGTGCCTGAGAATTGTGTGCAGATGAGCTTGCTTAACGA
TCTCAAATAAGCTTCCCATTATAATATTTATGCTTTCCCAGGTAAGGCCTCCCTTTCTAT
ATTCAACTTTAAAGCCAAATTACTGGGTTTTTTTAGTATCTAAGATGGCTGAAGTAATAG
GTGTTAGGGGAAACTGCCTTGCATTGCAGAACCATTCATTGAGCACTGCTGT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>24092 111 215     4q22.1    chr4:92149899-92149789 BLAT!
TCTTATTTTTTTGCTATGAGGTGAAGGTGGCAGATTCCATTTATTCCATCTGTAATCAGA
AATCAAACAATACAAAAGTGTTTATAGTCCAGGCTTTAATTTCATGAAATA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>1588 401 4081     4q22.1    chr4:92149992-92150365 BLAT!
GAGCGGCCGCCCGGGCAGGACGCGGGGGTTACACAGGGTTCTGGGGATAGCATTCAGCTG
GCCCCAGGATACTGATCACAGATAAAACTACCAGAGCACAGTTATATAATATATGTTACA
TATCTTGTAACGGAAAGACAACAATCCTTTATTTGTAACATCAGTAATCTGAGCAAGATA
GCTTTGGGAGCATTCTATAACCAGTTTGGCAACAGCAAGCTGTAGAGCGGGCCAATGATA
AATCACATTGAATCATCATTTGTGTGGCCAATGCAAGGAGTCTGCAGTATGAGCAGCATG
CAGCTGCCAATTTGTGATGAACGAGGAAAGGTAAAGGTTAAAAGAACACATTCGCACACA
AAACCTTGTGTTTTACAGGCAACTTCAAAATAAATTAGGAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>10916 400 4049     4q22.1    chr4:92149992-92150391 BLAT!
GTTACACAGGGTTCTGGGGATAGCATTCAGCTGGCCCCAGGATACTGATCACAGATAAAA
CTACCAGAGCACAGTTATATAATATATGTTACATATCTTGTAACGGAAAGACAACAATCC
TTTATTTGTAACATCAGTAATCTGAGCAAGATAGCTTTGGGAGCATTCTATAACCAGTTT
GGCAACAGCAAGCTGTAGAGCGGGCCAATGATAAATCACATTGAATCATCATTTGTGTGG
CCAATGCAAGGAGTCTGCAGTATGAGCAGCATGCAGCTGCCAATTTGTGATGAACGAGGA
AAGGTAAAGGTTAAAAGAACACATTCGCACACAAAACCTTGTGTTTTACAGGCAACTTCA
AAATAAATTAGGAAGATGGGCTGCTAATGGGCAATATGAC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>16090 101 220     4q22.1    chr4:92152412-92152312 BLAT!
ATTCCATTGTGGAGCTAAGCCATCTTTTATTCAACTATATCCCTTTCAACGACCATTCAC
TTTGTTTCCCCTTATTTTATGTATGCCATTGTGATTAATGC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>22997 222 881     4q22.1    chr4:92265407-92265628 BLAT!
GACACCAGTTCTTGCCAGTGCCTTGATTTAAGTTTCCCAAACTCCAGAACTGTGAGAAAT
TTTTATAAGTTACACAGTCTAAGTTATTTTGTTACATCAGCCCCAATGGACTAAGACTTC
GGCATAATAATTATAACAAAGAAATATCTACATTCTACATTTTAAAGCATAATAATGATT
TCTTCCAATTTCTGATATGGAAAGAAAAAGTAAGTGTAATGT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>17150 195 1443     4q22.1    chr4:92265413-92265219 BLAT!
TGGTGTCAAGTGGGGGCCTTATTCTTCAGAGATGGTGCATTCTATGTGTTCTCACATGGA
GGAAGGGGCAAACAAACTCTCTCAGATCCCTTTTATAAGGACACTAATCACATTCAGCTG
GCGAAGCCCTTAAGACTTAATCACCTTCTAAAGGCCCCACTTCTTAATACTATCACATTA
GGGATTAGGTTTCAA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>1552 194 1444     4q22.1    chr4:92265417-92265224 BLAT!
GAACTGGTGTCAAGTGGGGGCCTTATTCTTCAGAGATGGTGCATTCTATGTGTTCTCACA
TGGAGGAAGGGGCAAACAAACTCTCTCAGATCCCTTTTATAAGGACACTAATCACATTCA
GCTGGCGAAGCCCTTAAGACTTAATCACCTTCTAAAGGCCCCACTTCTTAATACTATCAC
ATTAGGGATTAGGT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>27731 226 1941     4q22.1    chr4:92304931-92304706 BLAT!
TTCCTTTTTCTTCACTTAATATATTTTAATCTTGTCCCTCCCACCCTCAATAAGAAACAA
ATAAAGTGTAATGGGGATTAGCAAATTTATTCTATACGGAGCAACATAGTAAATATTTCA
GGCTTTGCAAGCCAAATGTTTTCTGTTGTAATTACTCAACTTTGAAACTATAGCACAAAA
GTGGCTATAGTTTGTCCTAAAAAATATGATTGAACTATTTATCCTA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>7556 119 217     4q22.1    chr4:92305066-92305184 BLAT!
ATGGATCTCAGCAATAGACTTAATTTTAAAATCCCAACACTGCTGTTGGAAGATTGTGGT
GAAGGGCTGTGAGCAAACCTGCAGTTTTTGTTAAAGAATCAACTTTGGCTCCCAGTGGG


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

Shown 1-30 from 56 sequences on 1 of 2 pages.
Pages:  1  2

Databases: ABC2_contigs // chromosome: chr4 (only within introns)