Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 361-390 from 1945 sequences on 13 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>17816 196 1296     13q13.3    chr13:37760671-37760476 BLAT!
TCTCTCATTACCACGTGACATTGTCCCCAGATAACTCTACCTAAATAATACCTTTCCAAT
CTATTCCCTCCTCTATATTTCCTCCTCAAGCCCTACCTCAGGCCCTCAACCTCTCTTACT
GAGACCTGTGAAATAGTCTTCTAACTGGTCTCCCTGTCCTAACCTTTCCTCTTTCTAATC
CATTCTGCATAATATT


invisible?    
Gene introns: 0  

>1934 231 1292 15540+,79970+,16649-     3p26.1    chr3:5733818-5733965 BLAT!
TGATCATAATAGATGTAATTTATCCAATCTATGTTTTTATTGTCACCCATGAAAATGCTG
ACTTAAATCCTGCAGCTATTTGATCTCGGGCTTTAAATTCATCTGGTTCTCCTCATAGAA
CTCCAATAGTGTTTATATAAACATGGGGnATGGCCAGTTGGACTAGAGCATGAGTGCTGC
TCTAATTACTTGGCAGAGTACCTCGGCCGCGACCACGCTATAGATCGGAAG


invisible?    
Gene introns: 0  

>8061 235 1292     4q22.3    chr4:97199585-97199819 BLAT!
CATTAATAAGGGTTCTAACCTCATGACTTAATCACCTTCCCAAAGCCCCACCTCTTAATA
CCATGACCTTGAAGGTTAAAATTTCAACATATAAATTTCAGAGGGACACAAATATTCAGA
GCACAGCATAGGGTAAATATAAAATCTTTTGAGGTCTTACTGTAGTCAGTGCCCATCTTG
TTAACTTCCTGTTCACTATGCCCACCATGGTGGCTTCCTCCCATGCCATGTTTTT


invisible?    
Gene introns: 0  

>23776 335 1286 47316+,128605+,70731-,51818-,99N,142291+     3q29    chr3:195199564-195199230 BLAT!
GGAGCTTCACTATATCTACCACTGTGATATCACACAGAGCAGCTTCACTATATCGACCAC
TGTGATATCATACAGTGGAGCTTCACTATATCCACCACTGTGATATCATACAGGGGACCT
TCACTATATCTACCACTGTGATATCACACAGAGGAGCTTCACTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGAGGAGCTTCACTA
TATCTACCACTGTGATATCATACAGAGGAGCTTCACTGTATCTACCACTGTGGTATCATA
TATAGGAGCTTCACTATATCCACCACTGTGATATC


invisible?    
Gene introns: 0  

>24744 360 1274 151809+,204162+,187715-     1q25.1    chr1:173110305-173110533 BLAT!
AGAGATGCGGCCATCTTTTGTCATGTAGATGGAGAACTCCTTGATCAGCCGCTCCACCTG
TTCAGGCTTTAGCCCTGTGAAACAGAACATGCCAATTTGGTCGGTGATGTGTTGCCAATT
GTGGGTGGAACCCTCCTTCTTGAGGTTGGAGACCAGTTGAGTCCGCATGCCAATGATGCG
GTCAGCCATGCCTTTCACTTCTTGCAGCCATTGTTTTCGCAAATCTGGGnAATGGCAGCA
GCAATCCGGGCCCCATTGAGGGGAGGGTTGGAATACATGGGACGGATCAAGATCTTCAAC
TGTGACTCTACCCTTTTGGCTTCATCCGCATCCCCCGCGTACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>17716 336 1272     2p23.3    chr2:26251318-26251043 BLAT!
GAGCGGCCGCCCGGGCAGGTACTCTGCGTTGATACCTAAAGTGGAGTGGTCGGCGTTCCT
GGAGGCGGCCGATAACTTGCGTCTGATCCAGGTGCCGAAAGGGCCGGTTGAGGGATATGA
GGAGAATGAGGAGTTTCTGAGGACCATGCACCACCTGCTGCTGGAGGTGGAAGTGATAGA
GGGCACCCTGCAGTGCCCGGAATCTGGACGTATGTTCCCCATCAGCCGCGGGATCCCCAA
CATGCTGCTGAGTGAAGAGGAAACTGAGAGTTGATTGTGCCAGGCGCCAGTTTTTCTTGT
TATGACTGTGTATTTTTGTTGATCTATACCCTGTTT


invisible?    
Gene introns: 0  

>19722 186 1272     8p11.21    chr8:40851886-40852071 BLAT!
CGGAGACCCTATCTGGAAGGTAGCAGGGTAGTTCCCTCTGTAGGGGGGCTCTGCCACTGC
TGCGATCACCTCCAAGCCCCCTTTCAGATCAGCCAGGAGAGGCACCATAGACAGGCCAGA
GTTGTCTCTGAGGAAATGAGGGATGGGCCAGCACAGGCCGTGCAGGACGGAACCCGAGTC
CCAAGT


invisible?    
Gene introns: 0  

>4350 272 1268     1q23.1    chr1:157680165-157679895 BLAT!
TTGGGCTGGTAAGGGCTTCCATTTCTCAATACCCTAAAGAGAAAATGTTTGCGATGATCA
GGGCCACTATCATGGACCAATAGAAATTCAGGTGGTTGCCACCTTCTTTTATTACAGATC
TCCATCAAAGCAGACACAGGATGTTTGCCTGACAGATCTTTCATTGCAGCAGAGAAGTTC
CCAGACCTCTTTTGTGCTCTTTCTCCTACTGCAACAAGACCTTTTCGGTCTGTCTTAAAA
TCAACTAGGATGGGTTCCTTATTGCCTTCTTT


invisible?    
Gene introns: 0  

>6742 275 1262     11p12    chr11:40439619-40439346 BLAT!
ACTTTGTTTTGTGTAGGAAGTTTTACAGCTGTCTGCCTTTGCTCTTTCACCAAGGGAAAG
TCAAAGTGAGGAAAGTAATCAAATGATTCAGACATCAGAATTTATTCTGAAAGGTGCTGG
CATTATTACTACACATTACAACAACATTGGCTCTGCGTGATACCAGACTCGTGATTCAAA
GTGGAATTAGATTTGGCTTTTACCATTTTTGCGTAGCAGATAAACCCTAACCCATACTTC
ACTCCCTCAGAGTCTTGCTATTTCCTGAAATGGAG


invisible?    
Gene introns: 0  

>13260 190 1256     Xq28    chrX:147279800-147279985 BLAT!
GGAATCAAGATCATTGTCCTCTCTGGTTCTAGGATGGGGGTCCATAGGCCATACATCATC
AAACCTATGAAATGGCCTCTGGGAGCCCCAGTCTGGTGCTGGTTGGGGGGATTCACTTCT
TGCATCACTCTCCAAGACCCCCCCAAAGATCCTGGGCTGGTGACTATCTGGATACTTAAG
CATTGAGTCC


invisible?    
Gene introns: 0  

>1528 173 1254     4q32.3    chr4:165864660-165864832 BLAT!
AAAGAAGGCACGGAAGGCTATGTCCAAACTGGGTCTTCGGCAGGTTACAGGAGTTACTAG
AGTCACTATCCGGAAATCTAAGAATATCCTCTTTGTCATCACAAAACCAGATGTCTACAA
GAGCCCTGCTTCAGATACTTACATAGTTTTTGGGGAAGCCAAGATCGAAGATT


invisible?    
Gene introns: 0  

>2177 231 1246 39099+,80266+,57386-     5q14.3    chr5:89328609-89328734 BLAT!
AGAATAACCAGTTTAGAGAAGAACATAAATGACCTGATGGAGCTGAAAAACACAGCACGA
GAACTTCGTGAAGCATCCACAAGTATCAATAGCCAAATCGATCAAGTAGAAGAAAGGATA
TCAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAAATGTG
GGACTATGTGACAAGACCAAACCTACATTTGATTGGTGTACCTCGGCCGCG


invisible?    
Gene introns: 0  

>13994 199 1242     12q23.3    chr12:108674849-108675008 BLAT!
CTCTGCCTTCCTTAGAGACTGAGGCCCATCCTTCAGTTTTCCTGATTCTGGAGAATGGCC
CGCAGCCTCCCACTCAGGTCTTGGCTGTGCTCATCTAGTCCATCCCAGGGCTGGAAGGGA
CATCCCTGGTGGTCCACAAAGGTGTCCCAGCAGTGCTTAAATTCACTGTATGTCATTATT
GAAATTTTGGCCCCAGCCT


invisible?    
Gene introns: 0  

>378 117 1240     Yq11.221    chrY:16186404-16186520 BLAT!
GTGGCTCACGCCTGTAATCCCAACACTTTGGGAGGCTGAGGTGGGTGGATCATGAGGTCA
GGAGATCAAGACCATCCCGGCTAACATGGTGAAACCCTGTCTCTACTAAAAATACAA


invisible?    
Gene introns: 0  

>4992 203 1237     1p21.1    chr1:106240664-106240838 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGTGCCTGTCATTGCAAAAGCTGACACTCTCAC
CCTGAAGGAACGGGAGCGGCTGAAGAAAAGGATTCTGGATGAAATTGAAGAACATAACAT
CAAAATCTATCACTTACCTGATGCAGAATCAGATGAAGATGAAGATTTTAAAGAGCAGAC
TAGACTTCTCAAGGCTAGCATCC


invisible?    
Gene introns: 0  

>21273 196 1237     7q35    chr7:143263090-143263285 BLAT!
ACAAATCAACACAGACGATGTCACAGTATTGCACTAAAGAAGCAAGCCATAAAAGATTAC
ATAAAATATAACTTTCTTGTATTCTTATACAGTTTAAAACAAGTTAAAACTAAACTATGT
AGTTTAAGTTTGTGCACATAGGTAGTAAAACTAAAGGAGCAAAAGGAATGATCACAGAAG
TCAGATTAGTGTTCCA


invisible?    
Gene introns: 0  

>20158 195 1232     1p13.1    chr1:116408079-116408273 BLAT!
TTAATTTAGATTGAGTGGCCATAGAAGGCCTCTTTCAGAAGTTGTATTTAGGATAAGCCC
TGAAGGATGAAGGGAGTCTGCCAGGCAGAGTTGGAGCAAGAGTGACCCCGGAGAGAAGAC
TGTAAATGCATGGCCCGGAGGAAGGAAGGACCTTAGTGCTTATGAGGGACTGAAAGGAAA
TCAGCCTGGCTAGAA


invisible?    
Gene introns: 0  

>3126 247 1225     5p14.1    chr5:24826593-24826839 BLAT!
TGCTGCACTTGCAAAGGAACTATGTATGATTTATTTTGTTTCTGTTTTTCTATCAGTTTG
TTCATCTTTGAAGAGATGCAGCTCTGTCTGTGTCTACCTTTTACAAAAATGTGACTGGAA
TTGCTTTTATTCTCCCTATTTTTGTGAACAATTTTTGATATTTCTCATAGAAAGTATAAG
TGGGTAATCTCAGGGTTGATATTTTACATTTTGTATTAAACACTTGGATTGTTTTGAGTT
TGGGGGA


invisible?    
Gene introns: 0  

>3634 320 1224     12q24.23    chr12:119396056-119396375 BLAT!
TTTATTTGCTACATCTGTCCACCTTTTCAACAGGACACCTTTCCCTTTACATTCCAACCA
GAACTTTCAAAACCTAAGAGTAATTTACATAAAAAGTTTCTGCCTCTCATGAAAACTCAG
GTTCTCACATTGCCAAGCTGAAGTTGAATTTCAGTGAAGCAAGATGGATTTAGGTTAGAC
CCCTCCTCCAGACTCTCAAAAATCTTTCTGAGCAGTGTATTTGTTTTGTTCAAGAATATG
ACTTGCTGTATGGAGAATGTCATGGAACAGACTGGTTTCTAATGTCACAATATCCGTGGA
AGAAAAAGGTGGGAAAGCAC


invisible?    
Gene introns: 0  

>10502 111 1224     1q31.2    chr1:192216305-192216223 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGATGTAATGAAGCCTCTGCAAATTGAAAACAT
CATTGATCAAGAGGTGCAGACATTATCTGGTGGTGAACTACAGCGAGTAGC


invisible?    
Gene introns: 0  

>3392 184 1222     9q31.3    chr9:111593102-111592919 BLAT!
GTCCTCTCATTGTATTCTGTTTTCTCAAAGCACCTCACCATCACACCTCTTATCCCCATC
ACCAGCTTTCCTTCTGTGAAAACTTGGTTGGAAAAGCTCAGTTTCACAAAAGGTTTCTGA
GAATTGTTTTGTTTGATATTGAAACCTTCCCTTCTGCCTGTGATGTGATGGGAGTTTCAG
GGTT


invisible?    
Gene introns: 0  

>19902 247 1219     2q32.1    chr2:187445850-187446096 BLAT!
AAATATGTCTACTATTCAACCGTAAGTGGTTAGCTGGCCTCCGCTGCATTACTCTGAAAT
ATTACCCTCCACCATCACCATCAGACTTTCTACAGAATTCTGTTACATGCAACCACCATG
CATTCAGGTTCCTTTGTGGAATAAATGTAAAAGGGGCCATATTCCATTTTTTCAGTTTGG
ATGAAGTATGTGCAAGGTTGAGTAAATAAACCGGATGCAGAAGGTGAGGTGCCAGTGAGA
TTGGGAA


invisible?    
Gene introns: 0  

>2056 210 1216 27540+,80144+,32771-,43437-,31597-     6q14.1    chr6:77967097-77967230 BLAT!
GAAACCATCATTCTCAGCAAACTATCGCAAGGACAAAAAGCCAAACACTGCATGTTCTCA
TTCATAGGTGGGAATTGAACAATGTAAACACTTGGACACAGGGTGGGGAACATCACACAC
TGGGGCCTATCATGnCATACCAACATGGCACATGTATACATATGTAACAAACCTGCACAT
TGTGCACATGTACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>3653 202 1211     20p12.2    chr20:10368228-10368027 BLAT!
TCAGACTTTGGCTTTTTATGAAGGCGTTCAATGTCCCGAAGAGAAAGTAATTCACCCCTG
GGCTCTTCATCACTGTCTATTTCAATGTATTTCCTCTTCTGGCATTTCCCGGGGGCAGCA
TCAAGTTCTTTTCTCATTTGGGCCATGCGGATTTTCTGGAAGTCTTCCTGAGTTAAAACT
CGGCTAGTGCTGATGGCTGCAG


invisible?    
Gene introns: 0  

>16615 195 1211     20q12    chr20:37958218-37958409 BLAT!
TTATTCCTGTAATACCTGTGTTGTGATATGTATCTACCCATCCGCCATCACCATCATCTT
CTTCAATGATAGCTTCCAATTCATCTGAATATTCCATCTGTTTGCACCGCTTATAGCACG
GCACATTTTTGGTTACCAAAAATTGTTTGCCTGTTGGTAGGTATGCCTTCACTTTCAATT
CTTCCCCTGTAGCCC


invisible?    
Gene introns: 0  

>12317 227 1207     7q31.32    chr7:122567571-122567345 BLAT!
TAATAAAATGAGGGACAAGGCTGGGACTGGGGTGAGGCAAGTGACGTGCCTAGAGCACAA
AATTTCACTCTGGTTCGTGCAAGTGCTGTTACTGCATCAAACCTTGTATCTTAAACGATT
TTCTTGCGTCATCCTATTACCAGCTTTTCAAGGGAGAATGGTTGCTGTGGTCTGAATGTG
TCCGTGAAAAATTCACATGTTGAAATCCTAACCACCAAGGTGATGGT


invisible?    
Gene introns: 0  

>13625 199 1207     8q24.23    chr8:139769705-139769902 BLAT!
ATATTACACCACAAAAAGTGAGTTTCCAATAACAGTTATGAAATCAATCAATCAACACGT
GTTTTAATTGCTCTCAACTCACCATATAAGGGCCAATGTTCCAACAAATTTGGTAGGAAA
ACTAAGACCCTCGTATCCATCCCTAACAACTGTGTGTATACAGCTAACAGTTATTGGAGA
GACTCTGCCTTGCAGGCTT


invisible?    
Gene introns: COL22A1 (139600477 - 139926236)  

>2696 240 1203     1p22.3    chr1:85729387-85729626 BLAT!
TGGTAATTAAATAGTATGGCAAGTTCAGCATGATTTTAGCAGCAGCACTCAAGTTTTTTT
ATATATTATCTATCCTTAAGTTCAGCTCTCCTTTCAGAAAGCCCTCATAAGATTACATTT
AAAAACTTTAGATCAGTTTGCTTCTTGGTTTGCTTTTTCTCCAAAGTCAACAGTGGACAT
ATTTATCCAGTGATACAATATAAGACTAGAGTGTGAAACTTCCACCTCCTTTTTACATTG


invisible?    
Gene introns: 0  

>109 175 1199     15q22.2    chr15:62235804-62235960 BLAT!
CGCGGCCGAGGTACGCGGGGACCCCTACCTTTCACCATATACAAAAATTAACTCAAGATG
GATTAAATATTTAAGTGTAAGACCTCAAACTATAAGAATTTTACAAGAAAACCTAGGAAA
CACCATTCTAGATATCGGCTCTGGGAAAGAATTTATGACTAAGTGCTTAAAAGCA


invisible?    
Gene introns: VPS13C (62144589 - 62352664)  

>12582 250 1196     10q23.32    chr10:93792929-93792680 BLAT!
AGAGAGAGTCAATCAGGTTAATACAAGTTACGGTATCACAGAACTACAGTAGTAGCAGTG
GAGATGAAGACAGGTGAAGAGATTTGAAATATATTTTGTAGCTAGAGATGGTAGAAACTG
TTGATGGATTAGATGCAGGGGCATATAGAAAATAGTCCTAAGAGTGACTTGTCTCTGTTC
CCATGATCTCCCTTTCCTTCTGGACCTCCTAACAAGATTCTCTTGTTCAACATTCCAGTT
CACAAATTCT


invisible?    
Gene introns: 0  

Shown 361-390 from 1945 sequences on 13 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs