Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 391-420 from 1945 sequences on 14 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>14777 257 1183     5q33.2    chr5:153939781-153939525 BLAT!
GCCCCACCAGGAGCTAAAAAAGAAAACAAAGAGAAAGAAGAAACAGAAGGAGAGACCGAA
TACAAATTTGAATGGCAGAAAGGAGCCCCACGAGAAAAATATGCCAAAGATGACATGAAC
ATCAGAGATCAGCCCTTTGGTATTCAGGTTCGAAATGTGAGGTGCATTAAATGTCACAAA
TGGGGTCATGTCAACACAGATCGAGAATGTCCTTTGTTTGGTCTTTCTGGAATCAATGCA
AGTTCGGTTCCCACTGA


invisible?    
Gene introns: 0  

>23708 286 1179 41305+,203023+,111364-     1q32.2    chr1:208741358-208741559 BLAT!
TTTTTCTAAATGCTGAAATGGGATAAGCATGAAGGTGGGGGCAAGGAGGAAGGGGGAGAT
AAAAGGATGTCCTGCTACACTAAGGACAAAATTGGCTGTGTAGCTTTAGGAACATCATTT
AACTACTCCTGAGAGTCAATTTCCCTATGAGTAAAATAGCGATAATGATACGTCTGTTGC
AGGGCTCTTATGAAGAGGTAGnGTAGGCTCTCAATAATAAGGGAAGAATTTTGCCTAGGT
AGTTCCTGATATCAGTGGAGCTTAAGAGAAGGAGAACCCAGTACCT


invisible?    
Gene introns: 0  

>5713 211 1177     6q21    chr6:112938725-112938515 BLAT!
AATGTAGCTCACACTTTTGTGGTTGATGTAGCTCAGGGGACCCAAGTAACAGGGAGGAAA
GCAGATGTTATTAAGGCAGCTCACCTTTGTGCTGAAGCTGCCCTACGCCTGGTCAAACCT
GGAAATCAGAACACACAAGTGACAGAAGCCTGGAACAAAGTTGCCCACTCATTTAACTGC
ACGCCAATAGAAGGTATGCTGTCACACCAGT


invisible?    
Gene introns: 0  

>3254 216 1167     8q24.13    chr8:127194267-127194482 BLAT!
ATTTGCCACATTACTTGCAGTGAAATCTGATTCATAGAGCATAATTTTTTCTTCGTAGTT
CTTCAGCATCCATTACGAATTACTTTGTTAGTCTCTGAACATTTTCTTTTAATAGTTATT
CAATTACTCACTAATATCTGAAATGAGATATGGTCCCTGTTAATTTTCGGGTTATTTTTT
CCATAGACACATTGAAAATTAGAATCCCCTTTGCTT


invisible?    
Gene introns: 0  

>23746 272 1166 45302+,203080+,104013+,48137-     5p15.1    chr5:16231606-16231404 BLAT!
ACTCCTACTATTTCTGATTTTGAGAGGAAGAAACTGAGACTTTGAGAGTTACATAACTTG
CTGAAGGTCAAACAACCAGTAAGTGGCAGAACGAGAGACTCAAAGCCAATCTGATTTTGA
AGTTCGTTCTTACTATGCTACACTGCTTTCTGCAATCTTTAATAATTGCTAAAGCAGCCA
GATCATATTTATCTACTTCAATCnAATGATTTTAACCTCTCTAGAATTGAGCAAGTTTTC
AAATAATAACACATCCAGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

>20924 189 1164     8q11.21    chr8:50319169-50318981 BLAT!
TTGTAAGCATAAACACCAAGTCACATGGTTATATCAGTTATGAGGAGATGAACCATATAC
ACAAAAAAATAGGTCAAAAAGGGAAATGTAGAAATGCATATCACTGTGATTGGTAATTGG
GTGCACCCAGTTTTATAACTGGTTATCTACAAAACAACCTAAGTCATTTGATGAGATCAA
TCAAAAACC


invisible?    
Gene introns: 0  

>23078 186 1164     Un_gl0002190    chrUn_gl000219:153512-153327 BLAT!
AGGGAATGTGGGTGGGTCAGCACTTCTGTGTAGGTCCCCTTTTCAAATTTGCCTTCCAAA
AAGCCAACCAAATAAACAACCAAAAAATTGTGCAACAAAACACAAATAGCATTCCAACAG
CTTGGCAAGTGATGCATTCACCTGAGATTAAGTGGTTTTAGGTGGTCAGTAGCAAAATGC
TGCTTT


invisible?    
Gene introns: 0  

>10122 215 1161     10q21.3    chr10:66484270-66484056 BLAT!
CACCAACAGCTCCTCCAGGAAAAACATAAAAAGAGTAAGTTAAATTTATGTAATTGCTCA
GAACAAAAACATATTTGTCATTCCTGAGTTCAGTCTATCTTCCAAATTTTCACTAATATG
GAGAAAGGAAGCATAAAATGAACTCTATTGAATTGGATCATGGGTATTCGTATCAACTCA
TGGTATTTAATATACACACGGATAATTAGAAGAGA


invisible?    
Gene introns: 0  

>6837 222 1155     13q33.2    chr13:106812994-106812773 BLAT!
CTAAGAAACAGTTCTTTGAATACTTGCTTAGTCTAATAATTTATTCTAGGTGATTAGAAA
TTCATATTGACTCAATTGCCACTGCAACCAACACACCTATTTGGGTGGGGTGGGAAGAGA
TTGATGTTCTAGCTTTTTTAAAAGTATGAAATAGCAAATTTTCATATTTATATAAAAGGA
TGATATTTTAAAAACATGTAACAGAAAGTGATTATTCCATGT


invisible?    
Gene introns: 0  

>23546 346 1153 25440+,36536-     4q22.3    chr4:97824014-97824332 BLAT!
CGCCCGGGCAGGTACGCGGGGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACT
GTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCT
GTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGC
TGTGGCTTCATTTCCCAAGAAGCAGGAGTGACTTCAGTCATCCCAGCAATCGCTTGGTTC
AGTTTCATTCAGCTCTCTATGGACCAGTAATCTGATAAATAACCGAGCTCTTCTTTGGGG
ATCAATATTTATTGACTTGTAGTAACTGCCACCAATAAAGCAGTCT


invisible?    
Gene introns: 0  

>1840 302 1148 5808+,79790+,47479-     1q25.1    chr1:173110521-173110326 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGATGCGGATGAAGCCAAAAGGGTAGAGTCACA
GTTGAAGATCTTGATCCGTCCCATGTATTCCAACCCTCCCnAAAACAATGGCTGCAAGAA
GTGAAAGGCATGGCTGACCGCATCATTGGCATGCGGACTCAACTGGTCTCCAACCTCAAG
AAGGAGGGTTCCACCCACAATTGGCAACACATCACCGACCAAATTGGCATGTTCTGTTTC
ACAGGGCTAAAGCCTGAACAGGTGGAGCGGCTGATCAAGGAGTTCTCCATCTACATGACA
AA


invisible?    
Gene introns: 0  

>16052 167 1148     4q28.3    chr4:135865525-135865676 BLAT!
TCCGCACGTCTTCACTAAAGGAATGCCCAATGTTCTGCGCCGCATTCGGGAGTCTTTCTT
TCGCGTGGTGCCGCAGTTTGTAGTGTTTTATCTTATCTACACATGGGGGACTGAAGAGTT
CGAGAGATCCAAGAGGAAGAATCCAGCTGCCTATGAAAATGACAAAT


invisible?    
Gene introns: 0  

>17252 178 1147     20q11.21    chr20:29874363-29874540 BLAT!
CTGTGAAGAGTATCGGCCAAAAATATTCTTCGTGGAGGCCTCTGTGCCTTTGAGAAGGTC
CAGGATTCTTAGGCAGTGAAAGTAGTGAATGTAGGACCCAGACAGCAGCTGGGCGATCTC
TTCGCTCTCTGGCATGTCCTGGATGGCAGCATTGATCTTCTCGCGGATCGTCAGCACC


invisible?    
Gene introns: 0  

>22280 250 1145     11q14.2    chr11:85906633-85906882 BLAT!
TACGTCACTGCAATAATTGAGGAGCAGCCCAAAAACTATCAAGTTTGGCATCATAGGCGA
GTATTAGTGGAATGGCTAAGAGATCCATCTCAGGAGCTTGAATTTATTGCTGATATTCTT
AATCAGGATGCAAAGAATTATCATGCCTGGCAGCATCGACAATGGGTTATTCAGGAATTT
AAACTTTGGGATAATGAGCTGCAGTATGTGGACCAACTTCTGAAAGAGGATGTGAGAAAT
AACTCTGTCT


invisible?    
Gene introns: 0  

>5003 335 1142     5q34    chr5:160345223-160345557 BLAT!
TCAGCATAAAGGGGGAGGCAAACTTAGACCAAATGAGTATACTGGTTATAATTAGAAGTG
GCAATAAACTATATCAAGAAGTGGTAATAAACTACAGAGCTAGAAGAACACATAAACAGG
GGGCTTGATTGAGTCTAGGGACGTGGGCAGGGAAGGCTTCCGTGTGGCAATCACAGAATT
TATCTGAGCTCTGAAGGGTTAAAATCAGCAGGAGAGGTAGGAAGAGCATCTGAATGGAGA
GAACAGCGAGTATAAAAATCTTAAGGCTAGATAGACCATGATATTCACCATGATATTCAC
CATGATATTCACCATGAAATACCAGTGATACATCA


invisible?    
Gene introns: 0  

>1679 217 1138     10q11.23    chr10:52487156-52486944 BLAT!
GTGGCATTGCCTCACTATGTCTGATGGGTAAACTAGAAGAAGTTTTTTTCAGAAAAAGAA
TTGAACAGGATAAAGAGGTGGTGTATAATGAGGCAACAAAATGGTTATCATGGAAGACCT
AATAAGCCTGTAGACACCTGTTATTCTTTTTGGGTGGGAGCAACTCTGAAGCTTCTAAAA
ATTTTCCAATACACTAACTTTGAGAAAAATAGAAATT


invisible?    
Gene introns: 0  

>9986 154 1136     1p22.3    chr1:85730355-85730508 BLAT!
ACATTTGTCAAAACCCACAGGACTGTATAACACAAAAAGTGAACCCTAACGTGAACAACG
GACTTTGGATTAATAATAGTATCAAGATTCACTCATCAGGCTGGGTGTGGTGGCACACAC
CTGTAATCCTAGCACTTTGGGAGGCTGAGGCAGG


invisible?    
Gene introns: 0  

>2336 201 1129 54207+,79942-,14202-     17q23.3    chr17:62071718-62071854 BLAT!
GAGGAGGTAGCTTATTTTCACAGTTCCATGGTTTCTAATGATGGCACAATATTCTTTTGA
GTGAACTGCCTTAATTCACTCAACCATCCCCCTATTATTAGACATTGGGTAATGTTCAAT
TTTTCCTTTTTCTTTTTnGAGTAGCTGGGATTACAGGCATGCGCCACCACGCCCAGCTAA
TTTTGTATTTTTAGTAGAGAC


invisible?    
Gene introns: 0  

>1062 122 1128     17q24.3    chr17:69617518-69617631 BLAT!
CAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGCGTTTGTGAGGCATATCCTGT
CGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTT
CC


invisible?    
Gene introns: 0  

>16737 236 1126     2q21.2    chr2:135066496-135066261 BLAT!
GTTGCACAACTGAATATACTGAAAGCCACATCGAACTAATTATTTTCATTTTTTGTAGAG
ATGAGGTCTTGCTATGTTGCCCAGGCTGGTCTCAAACTCTTGAGCTCAAGCCATCCTCCC
ATCTCAGCCTTCCAAAGTGCTGGGATTACAGGCATAAGCCACCATACTCGGCCCTAAAAG
CCTCAAATCAAACACTTTAAATATGTGAAATGTGTGGTATGTAAATTATCTCAATA


invisible?    
Gene introns: MGAT5 (135011829 - 135206468)  

>16949 270 1123     3q13.2    chr3:112085536-112085805 BLAT!
GGTTACACTTTATTCTGGAGAATCCCTTTTCCATTGCATAGATTTCCCTTGGCTAGAGTT
GTTTTGTTTTCAACAGCATGTTTTTTAGCTTTGGATCTTGAGGAGAGAGAGCAGGAGAGC
CAATAAACAAGTCTGGGGAGGGGAACGTTTCCAGATACGTCAGGTTAAAAATAACAAACC
AAAAACCATGAACCACTCATTACAAAGCCAGATTTGAATGAATTTCCATTCACTCTCATG
AAGTTTCAAAAGCTAAATATATTGGAGAGA


invisible?    
Gene introns: 0  

>966 210 1121     7p12.3    chr7:48943096-48943295 BLAT!
CATTAGGCTAGATGCCAGGGCTTCTGCTTCAGTGGAAGGAACCTTGTAGATTTTTCCACC
CTTATAGACAAAGCTCCCTTCAGTCACTTTAAAATCCAGATAGCGAGTTACCTCTGTATA
AAGCAGCATCTTAACCAGCTGACCATTAGCCATAAGGAACTTGGGAATCAAGTCAACATT
CCAGTCTCTTCCTCTCCCCATTGACTCGGG


invisible?    
Gene introns: 0  

>3190 257 1113     3q13.2    chr3:112085820-112086076 BLAT!
GGGAAAAGATGAAAAGAAAGAAAACAAGTAACTTTACATGATTGGATCACCATTTTTGTT
TCATTTATTTAACCAAGAGATGGAATAGAGGTGCTGATATTATTAGGTGAAGGTTGTGAT
AATTTTATACCAAATAAATATATAATTTTCTTGTCATAAACTTTATGTTTTAATGAGTGG
TTTTCATTAGAAAGTGACACTGCATTTCTCATCATTAGATTATGTGTTTCTGCCAGTAGC
AGTTATGTTGATCAGAA


invisible?    
Gene introns: 0  

>8147 207 1111     12q13.2    chr12:55310139-55310345 BLAT!
TCAACGTTCCCACTTGTATTTCCGCTGATATTTTTAAAATATGGCAGATAACATTTGCAT
TCCACTTGGTAACCTTAATTAAGTAGGCCCCTAATCAATAAAAATCATAAACAGGATTTT
TATTTTACGGTTATTTAAACGCTATTCACTGAACAGCCAAGCTTTGTGCTAGGAAGGGAT
TTCTTTTTCTTTGGCTCCAAGCTCTTG


invisible?    
Gene introns: 0  

>24610 241 1110 138509+,202978-,38654+     4q22.1    chr4:93022373-93022217 BLAT!
CGCCCGGGCAGGTACCCCTGAACTGCATTCAAAAATTGCTAANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAAGTGCTCAGCCAGCTCCCTGCCAGAGAAACATGCC
TTATCCACAGGTTATAGAACAAACACAGATGCAGCAAAATGAGTCACCAGAGGAAAACAA
AAGCCTAAATTGAAGGTAAATGAAGCTTTGTGCACATGCATGACAAGAAATCCATTGAGC
A


invisible?    
Gene introns: 0  

>20115 225 1107     11p12    chr11:42768064-42767840 BLAT!
GCCAAAAAGCACTGAAAATATTATGATGTGGGACCCTTGGTTAAATTTTTGTGTGTGTGA
TCACCACAAAGCCCTGGATAAATATTTAAATTGTTTTATCTACTATGGTCAACTTGCTAC
AAGTCTTACAGCATGAAATCTTGCTGTAAAGATTTTGATTAATAGCAGAACATAGAGCAT
TGAGCTAGTTGCTGTCACTGAAAGTGGATATTGGGAATTTACCAG


invisible?    
Gene introns: 0  

>13170 201 1103     9q32    chr9:117609255-117609455 BLAT!
AGATCTCCTCGGAGAAGGGACAGAGGTCGGAGGAGCAGATCACGCTTGCGAAGGCGGTCT
CGATCACGCGGTGGTCGTAGACGAAGGAGCAGAAGCAAAGTAAAGGAAGATAAATTTAAA
GGAAGTCTTTCTGAAGGAATGAAAGTTGAGCAGGAATCTTCGTCTGATGATAACCTTGAA
GACTTTGATGTAGAGGAAGAA


invisible?    
Gene introns: 0  

>15897 209 1103     13q22.1    chr13:73912098-73911890 BLAT!
TATATACACACACACATATATATGTATGTGTCTATATACAGCTTTGTCATTAACTAAATG
AAGATAAAATGTGAAAAGAAAAATACTTGCAGTATAATTATATTGTTGAGGCAATTCTTA
TAGTGAAACAGAACCAGGTAATTGTAGAGTTTAGAAAGGGAATCATTCACATTCTCAGAC
AGTGATGCTTCTCTGATTAGGATACATGC


invisible?    
Gene introns: 0  

>24899 278 1103 168975+,203618-,87109-,50293-,15420-,46190-,175386-     4q21.22    chr4:84007972-84007796 BLAT!
ATAATCCCAAAAGACACAATCTTGAATGTTATAATCCCAAATGATGAAATCCTGAAAGAT
CAAAATCCCTGAAGTCCAAAATCCCCAAAATTCCAATCCCAAATGATTAAAATCCTGAAA
ATATAATTCTTGACAAAATAATTTTAAAAATTCTTTAAAATTCTTTATTTATATTTTnGA
AATAATAACATACTTTTTTTATTTTTATTTTTTATTGAGACAGGGTCTCACTTTGTCACC
CAGGCTGGAGTGCAGTGGTACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>22700 198 1101     6q25.3    chr6:157767121-157767318 BLAT!
GAAGGCTTCAGGACAAGTGGTGAGATGTGCTGCTGCCTCTCTAGGAGGGTCAGGGACTGA
GACTGCTTACAGGGTCCAAAGGAGATCTGGCTTTACCTCTTGGGACAGGTGCCTTGTGAA
AAAGCCATACACATTTCCTAAAAAGAAATGTCTTCAGCAACAGAGATCAGCAACAAATGG
AACCACACTGCACCTGCC


invisible?    
Gene introns: 0  

Shown 391-420 from 1945 sequences on 14 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs