Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 421-450 from 1945 sequences on 15 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>24179 353 1101 93697+,202986-,39031+     2p24.3    chr2:13672004-13672251 BLAT!
CGCGGCCGAGGTACTTTTTTTTTTTTTTTTTCAATTACCCGGGGGGAACCATCGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTTACGAAACCTGCT
GGGTTAAGGGAATTTTCAGTGGTTAATGTTAAATCATTTTTCTTTCTTTCTTTCTCTCTT
TGACTTTGTCTCTCTCTCACTTTCCTTTTGCCTCTGTCTCTTTCTCTTTCTCTCTGCCTC
TCTCTTTCTCTCTCTCTCTCTCTCTCCTTGACTCCCTCTTTGTCTGTCTCTTCCTCTCTG
TCTCTTTCCTTTCTCTCTCTCTGCTGGTCTTTCCTTGCCTCTGCCAGCCGCTT


invisible?    
Gene introns: 0  

>15393 218 1099     11q13.3    chr11:69586702-69586485 BLAT!
GATGTTTAAAAAAAGTTCCGAGGTGATGGCAAACATTTAATTTTAATGAATGACTTTTTA
GAGTTTATACAAAATGACCTTAGCTTGCTACCAGAAATGCTCCGAATGTTTCGTCAAGAC
TTTAATACTCTCCTAGGATGTTTCTGAACTGTCTCCCGAATTAACTTTATGGGAGTCTAC
AGACAGCAAGACTGGAAAATCTGATTGGAGTTTTTGTC


invisible?    
Gene introns: 0  

>24988 243 1091 179639+,102181-,153859-,45332-,142291+     3q29    chr3:195199320-195199078 BLAT!
TACCACTGTGATATCATACAGAGCAGCTTCAGTGTATCTACCACTGTGATATCATACAGG
GGAGCTTCACTATATCTACCACTGTTATATCATACAGAGCAGCTTCACTATATCTACCAC
TGTGAGATCACACAGAGGAGCTTCACTATATCTACCACTGTGATATCATACAGAGGAGCT
TCACTGTATCTACCACTGTGGTATCATATATAGGAGCTTCACTATATCCACCACTGTGAT
ATC


invisible?    
Gene introns: 0  

>9383 115 1090     6p21.2    chr6:36642578-36642692 BLAT!
GATGCTGAGGGGAGGCTCATACTGGCTGATGCGCTCTGTTACGCACACACGTTTAACCCG
AAGGTCATCCTCAATGCCGCCACCTTAACAGGTGCCATGGATGTAGCTTTGGGAT


invisible?    
Gene introns: 0  

>2344 347 1089 54999+,45361+,33715+,79772-,4655+     12q22    chr12:93110088-93110297 BLAT!
GAGCGGCGCCCGGGCAGGTACAGTGGTGCGATCTCAGCTCACTGAAATCTCTGCCTCCTG
GGTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGCCTCAAACTCCTGACCTCAAGTCGTCCACCCTCCTTGGCCT
CCCAAAGTGCTGGGATTACAGGTATTACAGTGTTTTAACCTGTAATATATGTAACCTGAC
AATGTGTAAGTGAGAAGTGCCCAATATACTCTTAGTTCTGAAATTGGCTAACTGGAAAAC
CCTTGCTCTCACGTTTTTCTTTGTGAACTCGTTCTTCCTGCCATTCC


invisible?    
Gene introns: 0  

>24169 277 1089 92460+,203670+,172737+     Xq22.3    chrX:107820455-107820290 BLAT!
TAATTTTTTGTATTTTTAGTAGAGATGGGGTTTCTCCATATTGGTCAGGCTGATCTCAAA
CTCCCAACCTCAGGTGATCCACCCACCTTAGCCTCCCAAAGTGCCGGGATTACAGGCATG
AGCCACAGCACCTGGCCTCTTGGTGGCATTTCTAAGATTTGGCTTCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGAGGAAATTCAAGGTGTAACAATATACTCAAGGGGCACCAAC
CCCGCGTACCTCGGCCGCGACCACGCTATAGATCGGA


invisible?    
Gene introns: COL4A5 (107683153 - 107940775)  

>14494 183 1087     1p34.2    chr1:43369673-43369491 BLAT!
GAAGCTACAGAGACATTCGTGTTTCTTCAAATATCAGAAGCTTCCACATCACAGCAGGAG
AGCTGACGACGAGCTCCACCTCCTGAAGGCTTAGTCCAAAAACTTCCTGTTGGCATTTGC
ACCAAACAAGGCTCCCCGGACTTCTGGCATCATCTGCTGGGCTATGAGATCCAGCCGGCT
TTC


invisible?    
Gene introns: 0  

>13307 207 1080     Xq11.1    chrX:62108481-62108275 BLAT!
TAGTCAGGGCCCTCTTCTGCAGATCTGCTGCAGTTTTCTGGTGGTCCACTCCAGACCCTA
TTTGCCTGGGTATCACCAGCAGAGGCTGCAGAAAAGCAAAAATTGCTGCCTGCTTCATCC
TCTGGAAGCTTCATCCTAGAGGGTCACTGGTCTGATGCCAGCCAGAGCTCTCCGGTATGA
GTTGTCTGTCAATCCCCAGTCAGGAGG


invisible?    
Gene introns: 0  

>21913 205 1079     5q22.3    chr5:113681283-113681079 BLAT!
GCCCCCCAACTCTTTCAGTGTTGTTCTTATCTGTAATGCAGCTAGCTTCTTTCACTGCTA
TTTGATTTCGATTTTTATTTCACCTACATCCTGGTTGATTTTAATTAGCATTCATTTGTC
TTTTGGGGTTTGTGAAATAGTGCAATGATTCTAAGTGTCAGAGCTATGCAACAGGTATAC
TCAGAGAAATCTGAATTCAGGAAGG


invisible?    
Gene introns: 0  

>2189 270 1078 40668+,2926+,79741+,77581+     6p24.3    chr6:9680965-9681104 BLAT!
AGCGTGGCGCGGCCGAGGTACAAAAGAGAGAAATTTTAAAGCTGGGTGTCTGGGGGAGAC
ATCACATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTCACATGCTTCAAGGGTGACAAAAGATCACAAGGCAGAAGGTCAGGGCAA
AACTAGAATCACTAATGAACTTCCATTTCCTGCTGTGCATGCACTGTCAGGGTTCAAGAG
CAGAGAACGGGTCTGACTAGAATTCGCCAG


invisible?    
Gene introns: 0  

>6063 210 1075     2p16.3    chr2:49089712-49089921 BLAT!
CTTTTTTCCCTTTATATTTATTTCCAAAGAGACCACAGCTAATATGACCTAACTATCAAG
CCTACAACTGCAAAGGCACTGTCATCCCCAGGTGGGAAGCAGCACAAAGTCATGGCAAAT
AGTGTATGTCAAGTTTCAGTTGTCATGAAGCCTCAGGTGATCAAGTCCACAGTCTCCCAG
TGATTTGCTTAAAGCAAAGGATCTCTCAGC


invisible?    
Gene introns: 0  

>20016 199 1074     7q22.3    chr7:105766208-105766406 BLAT!
AACTGTGAAGCAGTGGAAAATGGATGGGCCAGGCTATGGAGACGAGGAAGAGCCATTACA
TACAATATTAGGAAAGACAGTGTATACTGGGATTGATCATCACTGGAAAGAAGCTGTTTT
TGCCACATGTGGACAGCAAGTAGACATTTGGGATGAACAAAGAACTAATCCTATATGTTC
AATGACCTGGGGATTTGAC


invisible?    
Gene introns: 0  

>299 241 1072     1q31.1    chr1:187726518-187726758 BLAT!
TTTCTTGTAAATTTGTTTGAGTTCTTTGTAGATTCTGGATATTAGCCCTTTGTCAGATGA
GTAGATTGCAAAAATTTTCTCCCATTCTGTAGGTTGCCTGTTCACTCTGATGGTAGTTTC
TTTTGCTGTGCAGAAGCTCTTTAGTTTAATTAGATCCCATTTGTCAATTTTGGCTTTTGT
TGCCATTGCTTTTGCTGTTTTAGACATGAAGTCCTTGCCCATGCCTATGTCCTGAATGGT
A


invisible?    
Gene introns: 0  

>24387 181 1066 114075+,203740-,99384-,163259-     15q26.2    chr15:97210027-97209910 BLAT!
TTCTTCTAGGGTTTTTATGGTTTTAGGTCTAACATTTAAACCTTTAATCCACCTTGAATT
AATTTTAGTATAAGGTGTAAGGAAGGGATCCAGTTTCAGCTTTCTGCATATGGCTAACCn
TTTCTGACGGCTCTGTTCTGTTCCATTGGTCTATATCTCTGTTTTGGTACCTGCCCGGGC
G


invisible?    
Gene introns: 0  

>8231 114 1064     Un_gl0002160    chrUn_gl000216:2125-2226 BLAT!
ATTCCCCTGCACTCGCGTTGATTCCATTCCATTCCATTCAATTCCATTCCATTACAATAC
GTTCCATTCCATTCTATTCCATTCCGTTCCGTTCCATTCCATTCCATTCCATTC


invisible?    
Gene introns: 0  

>9375 175 1062     11p15.2    chr11:13778882-13779046 BLAT!
AACAAAATATGATGAACTTAAAGAGAGAAAGTCTTCCCTTAGGAATGCAGCATATTTCTT
ATCTAATTTAAAACAGCTTTATCAAGATTATTCAGATGTTCAAGCTCAAGAACCAAACGT
AAAGGAAACGTATGATTCATCCAGCCTTCCAGCTCTGTTATTTAAAGCAAGAACA


invisible?    
Gene introns: 0  

>9753 177 1061     Xq22.1    chrX:101034150-101034326 BLAT!
GTGGTTTCGGGCATTGAGGGCTTCACTACTGGTATATACAGAATGTCTGCTTGTAGCTGC
ATAAGAATTTTGTTGCTGGTCATTCCTCCATCTACCTGCAAATGACTGAGTGGAATTCCA
CAGTCTCGATTCATGGCATCCAAAATCTCTCGAGTTTGGAAACAAACAGCTTCTAAT


invisible?    
Gene introns: 0  

>775 290 1057     4q22.3    chr4:97824014-97824270 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGC
AAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATG
CCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATG
AGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGACTTCAGTCATCCCAGCAATCGC
TTGGTTCAGTTTCATTCAGCTCTCTATGGACCAGTAATCTGATAAATAAC


invisible?    
Gene introns: 0  

>2562 233 1057 75290+,80405-,53375-     12p12.3    chr12:16929223-16929070 BLAT!
CAACTGTGATTTCCTTTTTCAAAATTATTTTGGCTATTCTAGATCTTTTGCGTTTCCATT
TAAATTTTAAAATCAGCTTGTCAACTTCTACAAAAACAATTGGTCAGATTTTGATTGAGA
TTATGTGCAATCAATAGATCAATCTGGAGCAAnTCTCAAAATTCTGTGACAAATTTTTGG
TCAAGTTGTTTCCATTAAAAAGTACCTCGGCCGACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>768 149 1048     2q34    chr2:210045431-210045579 BLAT!
CTACCACCAACCAACAGATGTCACCCATCATTCAGTCAGGCTCCAGCAAACCTTCACCAA
TTTACATCAGTTCCTATTCCTCACCAGCAAGAGAACAAAATAGACGGCTACAGCATCAAC
AGCTGTATTATAGTCAAGATGACTCCAAC


invisible?    
Gene introns: 0  

>15041 211 1048     8q12.1    chr8:57909018-57908808 BLAT!
GAAAACTGCATTAAAGTGGAGAATTACAGAAAAAAACTAGACAGCTTAACAATTGAACCT
AAAACAAGTAAAAATATATCCACTTGTCTATCTTTTAAGGCAGGGTTTTTCATTGGGTAT
AGTTTCTAGTTGCAGTTTCAAGTTGTCTTACTTGCATCAGCCTACATAATTATTTTGCTT
TAATTTAAAAAGTTAACACATTTCCTTTTTT


invisible?    
Gene introns: 0  

>8290 241 1047     12q24.32    chr12:128226966-128226726 BLAT!
GCGGGCTGGCAGTTGAGTGTGCAAACAGGACCGACCACAGCATTAGATGTGTAAGTGAAT
AGGAGGAGGGGAGGCTTAGTGGTTAAAAGCTTGGGCTTTGGAGAATGTCTTAGTTCAGGC
CACTGGAACAAATGACCACAGACTGTGACTTACGAAAAACAGAAATGTGTTTTTCACAGT
TCAGGGGGCTGGATATTTGAATTAGGGTTGGGATGATCAGGTTCTAGAGTGAGCCCTCAT
A


invisible?    
Gene introns: 0  

>4997 376 1040     11q23.3    chr11:118099482-118099107 BLAT!
TTAGTGGGGGGCTTATGGAGTATTTCAGGAGTTCTTTGCAAATTAAATCATCTTTTCACT
TGTATTGTTTTTCAAAACTTTGTTGATTTCTAAAATGTGCCAACTGTGAGTAAACTATGG
TATTTGCAAGTGGTTTTTACATAATATTTGAGATGAGGAAGTGAGATTGTGCATGACATA
CTTCTCCTTTGTATTCTCTCAGTGCCTTACAGCAGGTTACTCCATTCTGCTATGACAACT
TGTTTCAAATGTTAATTTACATAGGATTTTTTATAAGCCATTAAGGCATATGTATAGTAT
ATCAGTAAAGATGGATGGTGCATATATAAATAGTCTTCTGTAATAGTGATTGGATTTACT
TCTCAATTATGAGAGA


invisible?    
Gene introns: 0  

>3121 204 1037     12q21.2    chr12:77593156-77593359 BLAT!
CTTTCTTGTCTTATTGTATGTTGTGTATTTTATCTGAAGGTTGGACATTTTATGTAGAAC
AAGAGAGACTGAGACTAATATTATTTACGTTTGTAAATGTCCACCTTTTCTTTTGCTAGG
TTTTAGAATAAAGATGTGAGGGAAATTGAGTCAATCTAATCAGGAGTGGAGCCGGGTGTG
GTTTTGTTGCAATTGTGAACCTCA


invisible?    
Gene introns: 0  

>5995 209 1037     Xp11.23    chrX:48306266-48306474 BLAT!
AGAGCACGCTCCAGTGCGGGCAGATCATTATAGGGAATGATGTCGAATCCCGGCATAAAT
GGTCCAAAACCATCGTAACTGGTTGGGTCTGTGGAACTGGAGATAGCAGACAACGTCCTA
CCCCAGAAGTTCCCAGCTGCAAAAACAATCTTTGCTTTGTATTTCTGAATGCCCTTCACG
GTATAGCCCCACTTACGAGCTAGTTTACA


invisible?    
Gene introns: 0  

>2952 211 1035     18q22.1    chr18:63942360-63942570 BLAT!
TGCTCAAGCATATAGTAGCTCTAAAGGAACCTCCATGCTGTTCTTAATAAAGGTTGTATT
AATTTACATTCCTGCCAACAGTGTGTGAGCGTTCCTCTTTCCCCACATCATCACCAATGC
TTGTTATTGCTCATCTTTTGAATAAAAGACATTTTGAATGAGATGAGATGACATGTCATA
ATTTTGATGTAATTTTCTTTCAATATATCTG


invisible?    
Gene introns: 0  

>7388 201 1031     1p21.2    chr1:100172951-100173151 BLAT!
GTATGACTTCCTAAATTTTTTATTTTAAAAATGCCCAGTTTATTTATTTGCTTTGCCTAA
GATAGCTGCATTCATTATTACAGGGTCAGGGGACTTGTAAAAACAAATATCAATTATTAT
AAATAATCACAGAAAACAAATAAACTGGAAAATAAACAGCGGTTACTAATTTAAGGTTTT
AACCCTTACCCCAACCACCCA


invisible?    
Gene introns: MIR548AA1 (100154610 - 100178513)  

>22165 211 1030     1p33    chr1:47530042-47530252 BLAT!
AGTGCCCAGCCTAGGGTCCTATTTTTAGCCTCCTTAAACAAAACAATGGTCAGCCAAGAA
TTTTGTATCCAGTGAAACTAACCTTCATCAATGAAGGAAAGATAGTCTTTTCCAGACAAA
CAAATGCTGAGAGAATTCACTACTACCAAGCCAGCACTAAAAGAACTGCTCAAAGCTCTA
AATCTTGAAACAAATTCTCAAAATACACAAA


invisible?    
Gene introns: 0  

>2599 259 1029 79335+,80470-,66612+     Xq22.3    chrX:107820450-107820306 BLAT!
TTTTGTATTTTTAGTAGAGATGGGGTTTCTCCATATTGGTCAGGCTGATCTCAAACTCCC
AACCTCAGGTGATCCACCCACCTTAGCCTCCCAAAGTGCCGGGATTACAGGCATGAGCCA
CAGCACCTGGCCTCTTGGTGGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
GAGGAAATTCAAGGTGTAACAATATACTCAAGGGGCACCAACCCCGCGTACCTCGGCCGC
GACCACGCTATAGATCGGA


invisible?    
Gene introns: COL4A5 (107683153 - 107940775)  

>6961 138 1029     10q11.23    chr10:52486982-52486845 BLAT!
AAATTTTCCAATACACTAACTTTGAGAAAAATAGAAATTCCATCTTATCAACTCAAGATC
GCCTCGTAGGGGGATTTGCCAAGTGGCCAGTCATCCAGGTGCTTTGCATGCATACTTTGG
GATCTGTGGCCTGTCACT


invisible?    
Gene introns: 0  

Shown 421-450 from 1945 sequences on 15 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs