Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 451-480 from 1945 sequences on 16 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>9595 189 1023     2q24.2    chr2:161394918-161394730 BLAT!
GTCAGCTAAGATGTTTCTCTGACATGGGGTCTGAGAGCTATACTCACACAGCTTGCTTGT
GCTGCTTCTGGTCCTGCTTGTGCTCAGCCCCAAATGTATCACTGCCATCTATACTGGATG
GTGACTGGGCCTGCCTGGCCTTATGACCTTGTAGGACTGACAGAACTCAGATCCTGATGG
GAGGTTCAA


invisible?    
Gene introns: 0  

>17141 194 1023     10p14    chr10:9062398-9062591 BLAT!
AAAAAGTAAAAAAAAATATAATTAGAGTGTTTATTCTTCCTTGATGATAAGGAGCCCTTG
ACAAGACAGAATGCTGTTGCCAGCAAGCCTCCTTCTTTACGTGTAATCGATCTTGGAAGT
TAAAGGTTTGTTTGCATTTTTAACATTGAGAGTTAAATATATTCCTTTGATTGAGCTGTT
AAGTGGCAGCTCAA


invisible?    
Gene introns: 0  

>19202 239 1021     14q21.3    chr14:49442912-49443150 BLAT!
TCAGCAATAGAATGTGGAAAGTGCCCAGCATTTAATCAATAATTATTAGACACGCAACAA
AAGAGAGAAATAAATAATAAAGAAACAATAATACATAATAAATTTAGTTATCATTAAAAT
AAATATTGTAAATTATCTATTACAAATGTTTTCCAGGATTTAGGCTAAAACATGACCATA
ATAAGAAAAAATTGAATATATAAAAAATAGCTAAATAGAACATGTAGAAAAGTTAAACT


invisible?    
Gene introns: 0  

>22354 271 1021     18q21.1    chr18:47022157-47021887 BLAT!
CAAACTTCAAACTCAAATATGGGCGGAAGAAGGAGGCAATTAGTGACCTACAACAGCTGT
GGAAACAAAATCCAAAAGATATTCACACCCTGGCACAGCTTATTTCTGCTTACTCACTTG
TAGATCCAGAGAAAGCCAAAGCTCTTAGTAAACACTTGCCATCGTCAGATAGTATGTCTC
TAAAAGTAGATGTTGAGGCTCTTGAAAATTCTGCTGGTGCTACATACATTCGGAAGAAGG
GTGGAAAAGTTACTGGAGATAGTCAACCAAA


invisible?    
Gene introns: 0  

>11828 150 1014     Xq26.2    chrX:131265119-131265268 BLAT!
AAATCGGGGCAGCATTTTTTTCAAATAGAGTCCTGGCTTTTCCTTTGCAAGCTGCAGGAT
TGAGAAAAACAGTGGCCTTCTTCACTTGTGCATTGGGAGGAATGAGTTGATTGCCAAACA
CCTGAGCTTCTTGACAGGCTGCTCTCCTTA


invisible?    
Gene introns: 0  

>750 160 1013     15q22.2    chr15:62236582-62236741 BLAT!
TAGGCGCCCATCAACAGTGGACTAGATAAAGGAAACGTGGCACATATACACCATGAAATG
CTACACAGTCATAAAAAAAGAATGAAATCATGTCCTTTGCAGCAACATGAATGCAGCTGG
AGGCCATTATCCTAAGCAAATTAACGCACGAACAGAAACC


invisible?    
Gene introns: VPS13C (62144589 - 62352664)  

>22574 270 1010     14q21.2    chr14:44270675-44270944 BLAT!
ATTGGCACTTCCATGTTTACTGTAGCACTATTCACAACAGCTAAAATATGGAATTAATCT
CAGTGTCCGCCAATGAATGAATGGATAAAGATAATGTGGCACATGTGATATAGGAAGTAG
AAAGAAATTTTTTAGGTGGATAGTGAGGGTAAAAGAGTCCTCAGCAGAGCTTCCCTTTTA
ACAGAAAGCAGCCCCAGAAATTATCTTTTCCTAAAAAAGACTAGCCTGAAAAATTGAGCT
GTAAATATAATTAAACAATCTGGAAGCTTG


invisible?    
Gene introns: 0  

>18441 181 1006     5p12    chr5:45400985-45401165 BLAT!
GGCTTTTTTTCCCACAAAAATGAATCCTATTATATATGCTCTTATTGTTGTTATCACATA
TAAAATGCCTCCAAATAATCTGTTGTTCACATAACTATGTAATAGTTTGTTGATCACACC
ATAGTTAATTCAGTCATTTTTTCCATTGTTCTCCAGCTTTTGCCACTACAAACTATTCTT
T


invisible?    
Gene introns: HCN1 (45259351 - 45696220)  

>523 106 1005     1_gl000191_random0    chr1_gl000191_random:1849-1954 BLAT!
GGCTCACACCTGTAATCCTAGCACTTTGGGAGGCCAAGGTGGGCAGATCACCAGGTCAGG
AGATTGGGACCATCCTGGCTAACACGGTGAAACCCCGTCTCTACTA


invisible?    
Gene introns: 0  

>21075 176 1001     7p14.2    chr7:35251675-35251500 BLAT!
AATATCTGTGTAATTGGAGGCCCTAAAGGTGGTTGGGAGGTGGGACAAAAAATATACCCA
AAGAAATAATATCTAAAAATTTTTCAAATTTAATGACAATTGTAAACACAATCCAAAGAA
GCCCAACAAACCCAAGCTCAAAAAGCATGAAGAAATAATACCAAATTATGTTATAG


invisible?    
Gene introns: TBX20 (35242041 - 35293711)  

>19702 276 1000     14q21.3    chr14:48481349-48481074 BLAT!
TTTTAAAGATATTTCATTACCTTTTTCTTCCATGCATGTTTCAGATGAGAAATTCTCTCA
TCCACATCTTAGCTTCTCTGTATAAAACATGTGCTTTATCTTCAGCTGCTTTAAACTTTT
CTTTTTGTCTCTGGTTTTGAGTAATCTGATTATGACATAATTAAATGACATAATCAAACA
ATTTTTGTCATATTTGTTTTGCTTGAGGCTTATTAAGGTTTTGGGATTATATGAGTTCAT
AATTTCCGTCACGTTTGGAAAAGATTAGCCATTATT


invisible?    
Gene introns: 0  

>414 118 998     Yq11.21    chrY:13668399-13668351 BLAT!
TTCCATTCCATTCCATTCCATTCCATTCCATTCCACTCCTTTCCGTTCCATTCCATTCCA
TTCCATTCCATTGTATTCCGGTTAATTCCATTCCATTCCATTCCATTCCATTCCATTC


invisible?    
Gene introns: 0  

>7447 216 997     3p12.3    chr3:75647188-75647403 BLAT!
CCCCAGGTGATTTGATTAAGGGCCAAGATTGAGGAAGGGCGACATGGATCTTTTCACATA
ACCTGCCTAAATAGATTCTCTAGAAGCAGTTTATAAAGAAATTCCACATGAACTGTGGAA
GAGGATATGAATTTGATATACAGTATGTCCTCACTTAACATCTTTGAAAGTCTCTTGGAA
ACTTCACCTTGAAGCAAAATTATGTATAGTGAAACC


invisible?    
Gene introns: 0  

>3069 202 995     13q31.3    chr13:90823892-90823693 BLAT!
TAGTACATCAATATTGAAGGTCTTTTTATCTTCAGGGTTTAGTTGATTCATTAACATATT
GACATTCTCAGTATTCCAAACCCAAGAATTACTTGTGAAATATTCAAGAAACACCATAGC
TTTGTGAAGACGAGTTATTGTTTTCATCATCCTTGGGCTTCTTCCAGTCATCCTGAGGTA
GATATCATACAGGAATGCTGGG


invisible?    
Gene introns: 0  

>5909 195 995     5q11.2    chr5:54221259-54221453 BLAT!
TGTAGTTACCTTTATTGGTGCTCTTCATTATCTCAGGTAGATTTGAGTTATGTGAAGTGT
CTTTTTATTTTGAATGACTATTTTTAGATTTCTTGTAGAGCAGGTCTGCTATAAACTACC
TCTCTCAGTTTTTATCTGAGAATATCTTAGCTTTTTTTTATTTTTGAAGGATAGTTTGCA
GAAGATAAAATTTTT


invisible?    
Gene introns: 0  

>4427 199 990     10q11.23    chr10:50423891-50423693 BLAT!
TATCTTGGAGATTGCAACAGGCATCACTGACTTATTAACATCTAATGTAGACTGATATTT
TTACCACTTTCCATACAATGTAAGGGTGTTATTCTTCAATTCCATTTACCCATCTGCCTT
ATGTGCTTTTGCTGTCATGCATTTCAATTCTACACCTATTTAAATCCCACAAGGCATCAT
TATTATTCCTTTACACAGT


invisible?    
Gene introns: 0  

>17447 215 983     3p24.3    chr3:20297577-20297363 BLAT!
ATTGTTGCCATATTTAAAAGGCATTTTAAGTTGGATTAAAAAATAAAAAGGCCCATCTGT
CTGCTGTCTTCAAAAGACCCATCTCACATGTAATGACACTCATAGACTCAAAGTAAAGTG
TTGAAGATCTATCATGCAAATAGAAAACAAAAAAGAGCAAGGTTTGCTATTCTTATATTA
GATAAACAAGACTTTAAACCAACAACAAGGAAAAA


invisible?    
Gene introns: 0  

>12464 200 979     9p21.1    chr9:29825372-29825570 BLAT!
TCAAAAGTATCAGGTATGCTCTCTGGGGCTGAGTGAGTAAATGGTTCCTGATAACTATCT
ATTTTTGCTTTCCGTCCCTTAACTAATAAACCATACTTGTCAAACATCCAGATTTTCTTT
TGTGCCTCTTGTTCTGACAGGCCATTTTCTACCATAGACATAACTATAAGATTTGCAATT
CCAAGAGCAGCCTCTCCTGC


invisible?    
Gene introns: 0  

>8303 231 978     7q11.22    chr7:70399283-70399053 BLAT!
CAACTTCAACCTCCTGGGCTCAAGTGATCCTCCCACCTCAGCTTCCCTGGTAGCTGGGAC
CACAGGCACACACCACCACATCTGGCTAATTTTGGGTATTTTTTGTAAAGATGGGGATTC
TCCATGTTGCCCAGAATATAAAGAGCTTCAATAACTTGCTGAAGTGTAGCCTCTACAGAG
GAAGAGCCACAGTTCAACTCAGGTATTCAGCTCCTAACTCATACTTTTAAT


invisible?    
Gene introns: 0  

>5244 179 977     17q23.3    chr17:62071700-62071879 BLAT!
ATTTCCATCTGAGGAAAAGAGGAGGTAGCTTATTTTCACAGTTCCATGGTTTCTAATGAT
GGCACAATATTCTTTTGAGTGAACTGCCTTAATTCACTCAACCATCCCCCTATTATTAGA
CATTGGGTAATGTTCAATTTTTCCTTTTTCTTTTTTTTCGAGACAGAGTCTCACTCTGT


invisible?    
Gene introns: 0  

>22484 205 975     8q11.21    chr8:50772330-50772534 BLAT!
GGAACCTCAAAAGCACTGCTATTTATGTAGCTAACATTGAGGGAAACTCACAGTCTCTGA
GGATGACCTGGAGACTGGCATGAGGTGTCTGTGAGTCTCAATGACCTATGATGATTGTCT
CAAATGAGATTCCCATTCGGTTCTTTATATACTGAACCAAATTTTAAGGCCAGATGAAGA
AATTGGTGGGAGTAGATGCTATTTA


invisible?    
Gene introns: 0  

>17989 241 971     3p25.2    chr3:12299683-12299443 BLAT!
GAAGAGGAGAAGATTCGTGTGGACATTTTGGAGAACCAGGCTATGGACGTCTCCAATCAG
CTGGCCAGAGTCTACTACAGCCCTGACTTTGAGAAACTGAAGCCAGAATACTTGGAGGAA
CTTCCTACAATGATGCAGCACTTCTCACAGTTCCTGGGGAAGAGGCCATGGTTTGTTGGA
GACAAGATCACCTTTGTAGATTTCCTCGCCTATGATGTCCTTGACCTCCACCGTATATTT
G


invisible?    
Gene introns: 0  

>17461 282 970     1q31.3    chr1:198031052-198031333 BLAT!
CCTTACCTCCATTGCAGAATAGTAGTCCAATTTCCACTTGGTAGTCTGGATCAATCACCC
AGTCCAATGTTGTAACTCCCTGCTTAGCCTATTGATCCAGAGGCATGAGGAACCCAAAGT
GGCCAGGTGGCAAAATAATTTCCAGTTCAGGGGAATCATTGTATCTTCTGGTGGAAGCAT
TCCTCCCTCTGGAACTAACAGCTCTAGACCAGCAGAGCATAAAGTTGAGGGAACAGGAAG
CAAAAATTTTGCTAGTGGGTCACTAGGGGTAATTGTGAGTGG


invisible?    
Gene introns: 0  

>23751 213 970 45617+,203085+,128339+     6q22.31    chr6:123180817-123180938 BLAT!
AAGATTGGTCTTCAAACATCATAGCCAATGATGCCCCGCTTGCCTATAATCTCTCCGACA
TAAAACCACATCAACACCTCAGTGGCCACCAAACCATTCAGCACAGCTTCCTTAACTGTG
AGCTGTTTnTCTAGGGATCTCAGCAGGGGTGGGAGGAACCAGCTCAACCTTGGCGTAGTA
CCTCGGCCGCGACCACGCTATAGATCGGAAGAG


invisible?    
Gene introns: 0  

>8631 250 968     Xp22.13    chrX:18884139-18883889 BLAT!
TGTCAACCAAAGCATTCAGATACCTGGAACCAGTGCTAGAGAGATTGGCGGGGGAAAAAT
TCACACTCTCCATGAGAAGGTCTTGAAGATACTTGGCTTCTGACTCGTATTCACTTGCTT
TCTGCTTCAAGTCCTCTATTACCAGGTAGACATCCCTGTCCCGGACCCTGTTGCGTTCTG
AAAGGTGATGTAAAATCTCTGTGGTCCGTGGGTTCACCTCATACTGTGGAATAGGATGAT
CTCCAAATAT


invisible?    
Gene introns: 0  

>23372 240 968 7027+,202447+,200384-,73367-,89187-,50028-     5p13.2    chr5:34606202-34606032 BLAT!
CTGAAAGAGAGCTGGGGTAGGAAATGCGATATTAAATAAGTGATCAGGGACACACCAAGC
ACATATTGTTTAAGAATTAGTAATATTAAATAGAAATTGTTGGAGAAAAAAAACCTTTCT
CCCTGTCTTATTTATTCACACATTGCTCATCAAAAAGCAAAACAAAATAACnAAAATAGA
CTGTGGGTCAGGCAAGGTGGCTCATGCCTGTAATCCCAGTACCTCGGCCGCGACCACGCT


invisible?    
Gene introns: 0  

>11383 288 967     12p13.31    chr12:8789783-8790042 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGGTGTCCAAGGGCTTCCTAGGTCGTAAATCTG
GGAAGGGCTTTTACATCTATCAGGAGGGTGTGAAGAGGAAGGATTTGAATTCTGACATGG
ATAGTATTTTAGCGAGTCTGAAGCTGCCTCCTAAGTCTGAAGTCTCATCAGACGAAGACA
TCCAGTTCCGCCTGGTGACAAGATTTGTGAATGAGGCAGTCATGTGCCTGCAAGAGGGGA
TCTTGGCCACACCTGCAGAGGGAGACATCGGAGCCGTCTTTGGGCTTG


invisible?    
Gene introns: 0  

>10089 210 966     12q24.32    chr12:128819460-128819669 BLAT!
CACATAGCTAAGACTATAAATTTTCCTTTCAATGTTACTTTGGCTGAATCTCTCAGTGCA
CTCATACTTTATTAGTTCTAAATAGTTGGAGATTTCCATGTTGATTTTTTTTAAGCTGAG
AGTCTTACATGTATCATAGATTGCAAAAGTTACAGGATTATGCCACATTTCGTTTTAAAA
TTTAGATTTGCATATGTGAATTCATGTATA


invisible?    
Gene introns: TMEM132C (128751947 - 129192460)  

>24718 239 963 148171+,204146+,174506-,44912-,146465-,83489-,74050-,81870-     6q14.1    chr6:80006861-80007011 BLAT!
TGCATCCCTTTCATGACACGTGGGGATTATGTGAACTACAATTCAAGATGAGATTTGGGT
AGGGACACAGCCAAACCATATCAAATATTGCTTGCAAAAGTATACTTTACCCAATTGTTG
TAAAGGTTAAGAGAAAAAAAAGTTTCTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTTTTTTTTTTTTTTTCCCCCCGCGTACCTCGGCCGACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>7435 206 962     1p13.2    chr1:116008482-116008277 BLAT!
TGAGGCAGGGCAGCTGGTCTTCCAGCTCCTCCTTTTGCTTGGCCCCAATTCCCCTTTGGA
TCTCTTCTCTCTGCCACTTTCCCTTTTCCCCGCAGGTTTCCAACTAGTCTAGGGAAGCTA
CCCCAACACACATCCATCCCATAAGTCTCAGAATGTGTAATATTTGTTAAGCCTGAGATG
CCCTCTCCCAGCTTTACCCTGCTCCT


invisible?    
Gene introns: 0  

Shown 451-480 from 1945 sequences on 16 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs