Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 481-510 from 1945 sequences on 17 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>4460 186 961     4p11    chr4:48454770-48454585 BLAT!
TCATTCCCAACAGCAATGAATGAAAGTTCCTGTTACTCCACACCCTTGTCAGCATTTGAT
GTTGTCAGTGTTCTGCATCTTGGCCCTTCTCATGTGTGTAGCGGTATCTCATTGTTTTAA
TTTGCATTTCCCTGGTGACATATGATATGGGATGTATATTCATATACTTATTTGACACCT
GCGTAT


invisible?    
Gene introns: 0  

>5331 230 961     9p13.1    chr9:40186030-40186259 BLAT!
GGTTAGGAATGTTTTAGGGTCTTGGTCTATATTTAATATAATCATGTGATAAATATATAT
CTAGTATCAAAATGGGTAGAAGCATTGAGGTTACAAAGCTTGAATCTTACATAGTATTTG
ATGACCTCAGTGTCGAAGAGAACAGGCAAACGAGTAAGTTGGTGGCCCCAGCATGTCGGG
TAAGGGCTGGAATTCTGAGAGTAGTGAGGAAACCCAGAGGAGCAGGTGTG


invisible?    
Gene introns: 0  

>10745 212 958     2p24.3    chr2:13435433-13435222 BLAT!
TTTTTATCATGAACTTTAAAGTAACACTAGAGGTAACTTTGAGAGTTTAATGATTCCTTT
GCCAATTCATATACTTGGTAATTGTAAGACCTTGAACTCAAACAGACTCAAGTTCTATAT
TCTGTTCATTTCATTCATCATGCAGCCTCTTAGTAGAGACAACTTGTCTATTGAAAATTC
TGCCTGAGGATTATTAACTGGAAATACCATTT


invisible?    
Gene introns: 0  

>21849 164 958     2p16.3    chr2:49060318-49060155 BLAT!
AAACAACTCTATATGAAAAATATCTAATAATCCAATTTCAAAATGGGAAAAAGGATCTGA
ATAGACATTTCTCAAAAGATAACATACAAATGGCAAACAGGCATATGAAAATGTGCTTGA
CATCACTGATCATCAGAGAAATGCAAATTGAAACTACAATGAGG


invisible?    
Gene introns: 0  

>22915 202 958     10q21.1    chr10:55387241-55387040 BLAT!
CTTTGCTCACAAATCTGTAATCTGGTTAGTGCTCAGTGGAGATAGTTCATCTCTACTATT
CTTGGCATCAGCTAGTGCCACAAGAAGCTGGGCAGTAGGATCTTCTGAAACTTTACTTAC
TCACATGTATGGTGGTAGAGGCTGGATGTCAGCTGAGACCTTAACTGGGGCTGTCTGCCA
GGACATCCACATATGGCCTTCC


invisible?    
Gene introns: 0  

>13762 204 957     5q21.2    chr5:103497783-103497580 BLAT!
TCTCTATTATCGTAATAGAAACCACATACCTTGGATAATAATGCTTAATTTCTTATTTTT
GACAGGAGCATCAGGACTTATCTTCTTTTAGTCACTGTGTATAACTTTAAAAATGTAAAT
AAACATAAATGGGAGGAGCACAGTTACTATTTGTTTAACTTTGACTTATAAGTTAATTGT
ATCTCAAGTAACTTTGGAAGAATC


invisible?    
Gene introns: 0  

>15457 182 957     3p11.1    chr3:88018812-88018631 BLAT!
CAGTCCAAAGTCTCATCTGAGACAAGGCAAGTCCCTTCCGCCTGTGAGCCCATAAAATAA
AAAGCAAGTTAGTTACTTCCTAGATACAGTAGAGGTAAAGGCACTGGGTAAATACACCCA
TTCAAAATGGGAGAAATTGGCCAAAACAAAGGGACTACAGGCCCCGTGAAAGTCCAAAAT
CC


invisible?    
Gene introns: 0  

>5994 224 956     Xq28    chrX:149283161-149282944 BLAT!
GAGTTAAACATTTGCACGTAAGCAAAGTAATTTCCATGTTTTTCAGTAATAAAAATTAAA
ACAGGATGTCTGAATACTACGAAAAACTTTGTCCATTTAATCACTTCTTCATCAGAGATA
ACAGTTTCAATTTTCTGCTGGGGGTCTGCAAGCAAGGCCTCTAAACCACGAACAGCACCT
TCCTTGAAGAGCACCAAGGGTTCTGTCCCTTGCACTGAAAGTAT


invisible?    
Gene introns: 0  

>10854 217 955     5q34    chr5:166524287-166524503 BLAT!
TGCACAGAAACCAAGGGCAAGTGGGGCCTTGGCCAAGATTTTCTTCCTTATTGATGCTGC
CATCACCAATATTTAATTGGCATCAAGGTAAATATTCAAAGCTTAATGTAGCATGCTGTT
AATGGATAATGAAGGTGTGTGGTCCTTACTGCCTCACTTTGCACCTGGAATGTAATTACC
AGCATAGGGATAGTCAGAGATGGAAGCAATGCATCAT


invisible?    
Gene introns: 0  

>20546 240 953     9q21.13    chr9:74204719-74204484 BLAT!
CTGGTTTTGTTTGGTTTGCCGCCAGGAGTGACTGTGTTGTTCTTTGCTTTATATACATAA
GCGCATCTCTTGCCCAAATAGAATTCTGTTTCATCTCGGGCGTAAACACCTTCAATTTTA
AGAAGAGCTGTGTGCTCCCTTTGGTTCCGGAGACCCCGCTTATAGCCAGCAAAAATGGCC
TTGGACCACAGCCTTCCAGACATAGTTCCTTTTAGAAGTCCCGTTCCCAGCAGGCCGGCG


invisible?    
Gene introns: 0  

>10718 199 951     11q14.3    chr11:90835600-90835402 BLAT!
CTCCATTTCTCAAACATAGTATTAGCTAACATATATTAGATCTTTATTGTATACACTCCT
CTATATCATTTACATAATGAACAATTTTGGTTCCCTCAAAACATATAAGGCTATTTATTC
TCATTTGAAAAAGATCTATGGAGAGGTAAAGTAATAAATCCAAGGTTTGACCACTAGTAA
ATAGACAACCTAGACACCA


invisible?    
Gene introns: 0  

>15570 162 950     19q13.2    chr19:39708116-39707955 BLAT!
GCTCGCGGCCTCCTCCATCTTCAAATAACATCTCTCCAACCTCTGCTTCCATCCTCACCT
TGCCTCCTCCTCTGTAGCCAAATCTTCCTCTGCCTCCCTCTTCTAGGGAGCCTAGTGATT
CCATTTAGGGTCCACCCAGATCTTCCAGGACAACCTCTGATT


invisible?    
Gene introns: 0  

>13246 235 946     18q22.1    chr18:65076726-65076492 BLAT!
TCCTTACTCTCATAGATCAGACTCCTATCATCTTTTGTTCCAATTTGTTATACTTGCTTT
TCTTTTATCATATAGGTAGACAAATGACATCCTTCCTTTAGGATGTCTTCAAAAAGGGCA
TTTTGGAATTCAAATGTCAGAGAATACAGTGTGAATCATTTTTGAGGATGGGTTTAAGAA
AGTGTCTACCTGCTGTCCTGGGAACCACTCCTCCTTTCCAAATCTTAGTTGTTTT


invisible?    
Gene introns: 0  

>4925 184 942     15q21.2    chr15:51254821-51254638 BLAT!
TTAAATTCTTTAATTCATTGTGGGTTGATTTTTTTATATGGTGAGAGATAGGGATCTCGT
TTCATTATTCTGCATGCTGATATCAAGGCTTTTCAACACTATTTATTGAAGAGGGTGTCA
TTTCCCCAATATATATTCTTGGCACTTTGACCGAAAATCAGTTAGTCGTAAATACACGGT
TTTT


invisible?    
Gene introns: AP4E1 (51200945 - 51298097)  

>6901 170 938     13q13.1    chr13:32768128-32768297 BLAT!
CTCTTGAAGAATATATGACATAAAAACCAAAATGAAAGCTCGGTCTTCCCTTTCATTTTA
CTCAGTTTATATTGACTAAGCTTTATCTGTATCTTTCTCTAGAACATTCTTTCATCAAAT
GGGAATAATATTGATTTGCTCCATGTATTCAGGTTCATCAACTTGGCTGC


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>6346 199 937     2q22.1    chr2:136888749-136888551 BLAT!
TGTAGCACATTATATATTCAATCTACAGGAAGATTTGGCACTTGGGGGTATTTAGACCCT
TCACAATAACTTCCCTTGGGGTCCACTGCTCACAGATTGAGAACCAGCCTGCACCACCTG
ACAGAGTCAAAGGTCAGTGATGAGCTCACCTTACCCCCCACATTCCCCTTTCCAGTAAAT
CACCCAAAAACCCAACTGT


invisible?    
Gene introns: 0  

>13825 189 936     Xq23    chrX:110864315-110864503 BLAT!
CTCTCTGGATTGCTGGGTTCACGTGGTAAACGCACTGCACTGATATTTAATCCTCGAAAG
AATTCCTTAATTGACTCTTCTGTAACATCATAGGGTAGGTTTCCTAGAAAAGCAGTGTAG
GGTGGCGATTTGGGAAGACGGCTCCGGTCGATATTGGGTTCCCGAGCAGCCCGTGGAGCA
GTGGGAAGG


invisible?    
Gene introns: 0  

>2991 167 934     Xp21.3    chrX:26669644-26669478 BLAT!
AAAAAAAAAATAAGCCTTGGTATTTCCCTGCAAAAATAAAATAGGCCACTTCTCAAGGGC
ATACTTTTCAGCCTCAGAATAGCTACAGTCAGGATGGCAAACTCTATTTGCCAGCCTCCA
GCCAATAAAAAGTCCTTAAAATCCTTCACCAACCTTTTCACTTGGGA


invisible?    
Gene introns: 0  

>12255 221 930     12q24.21    chr12:116137618-116137398 BLAT!
TATGGTGAGACATAAACGACTTCATGCACGTAAAGCTCTTAGCATAATGTCTGGGATGCT
CTAGGTGGCTAAGATGTGTTGATCATTACTTTTGCAACTCTTACTTTGTTTTTATGATGA
TCTCCTTTTGGCCATTATCAAGCTTGGAAACTGACAGATGGAGCAATTAAATGACTTGCC
CCAGGTCATGCAGCTTGGAAGTGACAGAGCTGGGATTTGAA


invisible?    
Gene introns: 0  

>17690 229 927     6q24.1    chr6:141885024-141885252 BLAT!
AATATTCAAATTGATGTGATAATCTACATTGTTATATTAGGGCACACTTCAATATCCTGG
CTACAGATTGCTTATCATATTAAAACTAAACACAAAATTGGTTTAAAAAAAAGAAAGAAA
AAAAAGTTTGTCATTATTTATAAAGACTCCATGAATAGCTAAGGTTCTCATGGTCTTGTT
TAGAGTCTTGGTGATGCAAGAGAATATCTATATGAGTTATAGCTTAACA


invisible?    
Gene introns: 0  

>13787 194 925     1q23.3    chr1:161396531-161396338 BLAT!
ATTTTAGGTTCATATCTTGGCTATTCAAGATATACACACACATATCCTATTTTTTCTGTT
TTGTCTGTAACTATGGAACTCTTACTGGATAGAAAGTGGTATACAGATCATGGGAATGTG
AATAGTTACAACCACTTTGGAAAGCTATTTGGACATACCTGCCACAGCTGAACATATGTA
TGCATGTTTCAGTA


invisible?    
Gene introns: 0  

>2332 217 924 53174+,80279-,40467-     4q21.22    chr4:84007966-84007814 BLAT!
CCAAAAGACACAATCTTGAATGTTATAATCCCAAATGATGAAATCCTGAAAGATCAAAAT
CCCTGAAGTCCAAAATCCCCAAAATTCCAATCCCAAATGATTAAAATCCTGAAAATATAA
TTCTTGACAAAATAATTTTAAAAATTCTTTAAAnTTTTATTGAGACAGGGTCTCACTTTG
TCACCCAGGCTGGAGTGCAGTGGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

>18424 210 923     1q31.3    chr1:195404201-195403992 BLAT!
AAAGTGAGTCATCCAATTTGCATCCCCTATGGCAACCGGACACAATGCTATCACTTTGAG
AACCTATGTCAACATCCCTCAACTCTTTTCAAGCATCAGGGATCCAGGAAATCTCTGTGC
TGTAGAAGGACAATGAGGGGACACAGACAACAGTAGCCATATTTGCCAATAACTGAAGAT
CAAGATGAGGAAGGAAGACAGAGTGATAAA


invisible?    
Gene introns: 0  

>9399 201 921     12q21.31    chr12:83494964-83495164 BLAT!
TGGACCACTAGTGTTTTGTTTTTCAATATCTAAGCATTGCAATTTTAACCCTACTGTTTG
TAAGCAATGGGCCAGTTGCAAAGCTATAAATTTTGTGTTTCTTCAAGTAAGTATTGATTT
ATTTTCCTTCTTAAAATACATAAAGCAAAAACTAAAGGCTAAACTGAGAATGATTTCATA
GACCCCAAATACTTTTTAATA


invisible?    
Gene introns: TMTC2 (83080933 - 83528067)  

>10455 182 918     18q22.3    chr18:68973202-68973021 BLAT!
TTTCTGATCCTAAAGAGATTAGTTGAGAGTCTAACACTTTTCAAAGATATGAATGGGAAA
CATTAGCCATGTTGCCTTTAAAGGCAACCTTTACCTAGGAGACCTCGTCTGCATAATAAG
AACTTTGGTCTCCACAACCCCCGTCTTAACCCAGGCACTCCTTTTTATTGATTCCAGGTC
TT


invisible?    
Gene introns: 0  

>9371 183 917     9q21.32    chr9:84701293-84701113 BLAT!
AATACAGAAGCTCTGAAGATTCAGATAGTGAAGATATGGAAAATAAAATAAGTGATACCA
AGAAGAAGCAGGGGATGAAGAAGAGGAGCAACAGTGAAGTGGAAGACGTGGGACCAACAA
GTCATAACAGAAAGAAGGCCAGGTGGGACACTTTAGAGCCTTTGGATACCGGCCTGTCTT
TAG


invisible?    
Gene introns: 0  

>18599 233 914     17q24.1    chr17:62743457-62743225 BLAT!
GGCTTATTCCAACTGTCAGCATGATTTCCAGGCTCCATATCTTCTACATGGAAAATATGT
CAAAGAGCAGGAGCAGTGACTTCACCTGAGAACATCCCAGCGGGAGGACAAGAGAAATCA
TGTTTATTCCTCAGGAATACTGAAGTGCCCTGGAGTAAGCTGCCATTCTTCTGTAACAAT
GTTATCAGTAATGCTTTAAACTCCAGCACCTGGTTATGCATTTGAAACCAAGT


invisible?    
Gene introns: 0  

>21669 161 910     22q11.1    chr22:16682786-16682946 BLAT!
AAAAGCAAAACCTCTGCCTGTGTTTAACTTAAAATGTGCTAAAAGACAAAGCTCCAGAAA
AGTGACAGTTATAAATTCAGATAGATACTGTAAGAAAACAGATTGCTAAGAATTAGATCT
ATACTAGGCTCACGGAAAATTCCCCCGAGGGATGTATAGCT


invisible?    
Gene introns: 0  

>4711 288 909     Xp22.33    chrX:3098234-3097947 BLAT!
TGCACTGCTTCCTGCAGAGCTGAGAAAAATAGCTCTTCTCCAGGCTTAGTCCTGGACTGT
GTCTGTTCTTTGACGTTGTCTTCAAAACTTGAAGTTCACGTGATTCTTTTTTAATTTAAA
GAAAACATATATCCTGGCCAGGTGCAGTGGCTCAGGCATGTAATCTCAGCATTTTGGGAA
GCTGAGGCAAGTGGATCACTTGAGGTCAGGACTTTGAGACCAGCCTGGCCAACATGGTGA
AATCCCATATCTACTAAAAATACAAAATTAGCTGGGCATGGTGGTGCA


invisible?    
Gene introns: 0  

>689 111 908     4p11    chr4:49637083-49637166 BLAT!
GGAATGGAATGGAATGCCTTCAAACCGAATGGAATGGAAGGGAATGGAATCAACACGAGT
GGAATGTAATGGAATGGAATGGAAGGGAATGGAATGGAATGGAATGGAATG


invisible?    
Gene introns: 0  

Shown 481-510 from 1945 sequences on 17 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs