Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 541-570 from 1945 sequences on 19 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18142 198 863     10q21.3    chr10:66484250-66484447 BLAT!
TTCCTGGAGGAGCTGTTGGTGTGGAAAAGATTGAGAATTGGAAATCTATTTTTGGACATT
GGCATGTTTCATGTTAGCTGACTATTACATGGCCAAGCAGAATTGTTAGGCAGGGAGCAG
GCTATTAATCAAATTCTCAGGGGGAGACATTAAGGCTGCAGATAAATTTTGGAATTTGCA
GAATATAAATGGCACTAA


invisible?    
Gene introns: 0  

>8049 188 861     3p25.2    chr3:12299350-12299537 BLAT!
GGCTGGACTTCATGTAGGCAGAGATCTTCTCCAAGCCCTCAAAGCGGGAGATGAAGTCCT
TCAGATTTGGGAAGGCGTCCAAGCACTTGGGCTCAAATATACGGTGGAGGTCAAGGACAT
CATAGACGAGAAAATCTACAAAAGTGATCTTGTTTCCTGCAAACCATGGCCGCTTCCCCA
GAAACTCT


invisible?    
Gene introns: 0  

>18848 184 861     8p11.21    chr8:40851415-40851598 BLAT!
TTCAGGTGCTCCTTTTCCAGGCAAAACCTGCCACCATGTGGAAGACGGTGGCATTGCAGC
CCCTTGTCCAAAAATCTCGCTTCCACAAGGACAAGGGGACGTTCTGAGCCAAAACACAAA
GTCAAAACACAGCAAAGGGCTCCTCAAAACGATGATCAGCAAGAAACCATTCTCTGTCTA
CTTT


invisible?    
Gene introns: 0  

>13435 181 860     10p11.21    chr10:37300077-37300257 BLAT!
AACTCTGAAGAATTAATCCAATTTTAGAATTCCCCATAAGACAGGCTAAGGCCATTATTA
TAATTGCATTGCAATTCAACTACTCTCTTAGCCCCTTCCTTTGACCACAGCTGTGATCAT
TCCCAATAAACTTCTTGCACACAAATTCCTATCTCAGACTTTGTTTCTTATGGAGCTCAA
A


invisible?    
Gene introns: 0  

>15223 164 859     11p15.1    chr11:19415579-19415742 BLAT!
AAGACCTGCTTTACTTGGGGGAGGCAGTGAAGTGAGAAGTCAAAGGAAACATCATAGGTC
TCTTCTGGAAGCTAAACTCTGAGCCATTCAGCATGGTTTCATTCCCATGGATTGCATCAT
AGCCAGGAAAGTCACTGAGTCTCCTTAACATCCTGGATGCTTTT


invisible?    
Gene introns: NAV2 (19372270 - 20143147)  

>13620 208 858     2p22.3    chr2:36306344-36306137 BLAT!
CTACTTGTTACCTTTACTTTAACCAATGAAGCCAATATAGTTATCCAACATTTACAACCA
GTGAAGTCATATTGTCGCTAGGTAGTAGAGGTGGAGTTTGAAGCCACATCTGCCTCTGAA
GCTTGTGTTTATTCCACTACATCTTGTTGGTTTGCTGAGAAATGAGGTGTTTAGAATTTC
TTCCTTAAAAACTGCAGTCACTATAACA


invisible?    
Gene introns: 0  

>7906 177 855     1p35.3    chr1:29196033-29196209 BLAT!
CTCATTTAATCTTCACAGCATGATGATGAGGTAGGCATAGTATCATTACCTCCATTTTAC
AGATGGGGAAACTGAGGCTCAGAGAAGGGAATGACTTGCCCAAGACCACATGGCTTCTCA
GTGATTGGCTCAGCTAGGATCCCACCTTTGGTCCTTCAAGTCCACTTCCTCTGCTTT


invisible?    
Gene introns: 0  

>17248 237 854     1q32.2    chr1:207589684-207589920 BLAT!
CTCCTATGCACCTGCTATCATTTCCTTTTATCATCTAGCTCCCATTCCTGTATTTCCCCA
AACACCAAAAACACATTGCTGCTGGACATGTTTTTTAAAAAGCATTTTTAAAGGTTTAGC
AATAGCAGAAGATTATTGCCAAAAGAAAGCAGAAAAACAAGTTAAAAACAAATAGTAGGT
GTCAATGTTGCACAAATTTGCTAACCTGCACTGACCTAGTGTATACATCCAACCAAC


invisible?    
Gene introns: 0  

>3841 211 848     12p13.2    chr12:12096152-12095942 BLAT!
TCAACTCTGAGTCGGAAAAACCTGTTTATGAGTTGTGCTTAGTTATTTACAGATTGTGTG
ACTTGGGGTAATTACTTATCTGAAACCTCACTTTGTTAATTTAAAATATGAGATTAATAA
TTCATTTTATCACATGATGGTTGCAAAACTTCAATGAGAAATCACAGGTAAAGCACTCGG
CATTCAGTAAATGCCTCCAAATGGTAGTTGT


invisible?    
Gene introns: 0  

>4724 207 848     12q22    chr12:93110321-93110115 BLAT!
CTTAAATATTACAGAATGAGAGAGGGAATGGCAGGAAGAACGAGTTCACAAAGAAAAACG
TGAGAGCAAGGGTTTTCCAGTTAGCCAATTTCAGAACTAAGAGTATATTGGGCACTTCTC
ACTTACACATTGTCAGGTTACATATATTACAGGTTAAAACACTGTAATACCTGTAATCCC
AGCACTTTGGGAGGCCAAGGAGGGTGG


invisible?    
Gene introns: 0  

>10051 295 848     Xq22.3    chrX:105682771-105683065 BLAT!
TGAGGCCACCTTACACACTGGCTATAGATGGCAGGAACATCCAAAGTCTTTGAGAATTAG
AAGTCCCTCCACCCTCTTTCTGTGAATTGGGAGGGTTTTTAGAAAAAGTCTGTGAGAGGG
CCGGGCACAGTGACTCACACCTGTAATCCCAGCATCTTGGGAGGCCAAAGCAGGAGGATC
GCTTGAGCCCAGAAGTTCAAGACCAGCCTGAGCAACATAGTGAGACCTTGTCTCTACAAA
AAATAAAAATTAAAAAATTAGCCAGGTTTGGTGGTGCATACCTGTGGTCCTAGCT


invisible?    
Gene introns: 0  

>19882 197 848     1q31.2    chr1:191723213-191723409 BLAT!
AGTTCACTCTAAGCTGTTTGCAGAGACTCTAGAACTACCCCTATTGATGGATGGCAGATG
CTAGTTTGGATGAGAGAAATGTAGTTTTATTTAGCTGATTAATGAAAATATAACCTGCAA
GTGCAAGATGAAAGGAGAAGTTATTCACAAAGAATGGGTGCAGAGGGAGATCTTAGCTTA
AAGAAAGGGAGAAAGGT


invisible?    
Gene introns: 0  

>3641 198 847     5q15    chr5:98140730-98140927 BLAT!
TCATATTTGAATAGGTAGGCTTGGAAAACCCCCAAATACCCTCCCTATAATTAAAAATTT
GTAGCTCTCCATGTGGTTTAGTATTCTCAAAAAGATAAGTAAGGAAGTAAAAAATTCCAG
ATGGCAACATGAGAGCATCCAGATATATAATTAGGTCTAAAGAGAATTAGGCAAATATTA
GGTCTAAAGAGAAAGATA


invisible?    
Gene introns: 0  

>11901 199 846     Xp21.3    chrX:27536234-27536035 BLAT!
TGGGTTATTTCTTGAATTAATTCCTCAGAAACATCTTCAGGAAAGAATTTAGCTCTAAAC
TTGAACTGTAAAGGATTCTCTTTTTTAACATCCTGCTGTGTTACCTTTTTATTTAGTTTA
AGCCATGTAGAATAACCTTTGCTGTCTACATACTGCAGCCCAAAAAACCAGACCTCACGC
AAACCAACTGTTTTCACCA


invisible?    
Gene introns: 0  

>3289 217 845     13q14.2    chr13:49785602-49785812 BLAT!
CAAACTCTTCTTGAATTTGAACTTGGTAATCCATGTCCAGATAAGTAGGGTTGATCCAAT
CATACAAAATCTCATGATCTTGTGGGATGTGAGGGCTCCGAGGTATGGGGGGTTCAAAGT
AGTTGGGAGGCCGAGTCAATGATGGACCATGAAACCAGCCACTTATAGACAAACGTGACT
TTTCTTCAGACAGCACTTCAGACACCTGGTGAAAGGA


invisible?    
Gene introns: 0  

>15603 156 845     21p11.2    chr21:10822471-10822410 BLAT!
TCCACCCCATTCCATTCCCTCCACCCCATTCCATTCTACTTCTTTCCATTCCTCTCCAGT
CCATTCCACTCCAATCCACTTCATTCCATTTCACTCCACTCCATTCCATTCCGTTACATT
GCAATCCATTCCATGCCATTCCACTCCATTCCATTC


invisible?    
Gene introns: 0  

>136 161 843     9p23    chr9:10961734-10961894 BLAT!
GCCCTGTGATTAAGGTCAATGGGAAACCACAGCAACCCAATTCAGGCAGGACTACAGATG
GTCCAGACCCTTCAGGAATGAAGATTTGGGTTACTCCATCAGGTAAAAAACCATGACCTG
CTGAGGTGCTTGCTGAAGGCAAAGGGAATACAGAATGGGTA


invisible?    
Gene introns: 0  

>10266 207 843     4q13.3    chr4:74951826-74952032 BLAT!
AATTTCAGCGTCAATTTTATTACTGGTCTCTGAAATAATACTTTTGGTTTGAGTATCCTT
TTTTGTAAATTCTGTAGTTGTTTCCATAAGTTGCTTTTCTTGATCTGTAAACATATCTGT
TACTCTGCTCCTTTCTAAGTTGATATCCAGTTTATTATCTGCTCTGATTCGACTGGTTTC
ATGCATTAGTTGTTGCTTAACTTGGTC


invisible?    
Gene introns: 0  

>4180 177 840     8q23.1    chr8:107187859-107187683 BLAT!
GAAAAGCTTTTGATAATAAACGTGACTTGCATTACCTTGTATTTTATTCCTTCCCATTTC
AATGGCATCAAGAATGACAAAGAGAGAAAGAATTAAGGTGGAGAAAGGGAATAGACTTTC
CAGAAATTGAGTTAACTATTTACCAATTCTAACGCAAATCCAGAAACTATATCAATA


invisible?    
Gene introns: 0  

>10230 171 837     2p24.3    chr2:13671651-13671481 BLAT!
AAAGGGGAGGGGGCAGAATTTATATAAAAAGAATGTTATATGGTAAATTCTTGTCCTGAA
ATAAATTAACTGGTTGTTTAAAGAAAGAAATGTATGTAATAAGTCAGAAAGTTAAGGCAG
GTCGAAAAATTGCCTGTAAAAGTTGTGAAAGAAAAAAAAGGTTATTAAAAA


invisible?    
Gene introns: 0  

>21393 110 837     Yq11.21    chrY:13680015-13679902 BLAT!
AATTCCATTCCATTCCATTCCATTCCATTCCATTACAATGTAGTTGATTCCATTCAATTC
CATTCCATTCAATTCCATTCCAGTCCTTTCCATTCCATTCCACTCGGGTT


invisible?    
Gene introns: 0  

>19011 267 835     19q12    chr19:29581670-29581404 BLAT!
ATACATTTTTAGAAGGAGAATTTCCAGGGCAAAATGCATGCGGCTCTGTTTATACTGGTC
GCACTCTGCAGATTTTCTTTACTCCCATGGCCTCGTGTCCTCTCTGTGCCAACCACATCC
AAATCCAGCTCCATAGCCGGACCTGTAGCTTCAGGCTTCTAGACCCAACACTCTTCACTG
GCCATCGTCTCAGCCACTTAGAGTGAGTATGCTGAAAGTGGAACTCAGAACCTCCTATCC
AACCCACCATCTTCATAATCACCATTT


invisible?    
Gene introns: 0  

>2136 222 830 35397+,80231+,65830-     13q21.1    chr13:55756885-55757022 BLAT!
AGTATTTTCAGAAGTTAGTAGAAACATAGGACATATTTCTAATAGAGTCTCCAGTAAACT
AGCTTTTAAAAGGTGTGCTTTACATAAGAGAAAAATAGTTGTCAGTGGAAATCTAAAGGT
AAAAATTTAATATTAAGnCATGAGTTGGAAAATAGTTTATTGGAGTTTAAATGTTCTAAC
ATCTGTGTACCTCGGCCGCGACCACGCTGCCCTATAGTGAGT


invisible?    
Gene introns: 0  

>5384 202 830     2q14.1    chr2:117735753-117735954 BLAT!
AAGAGCGAATGCTCTTATAAGTGTTTTAAAAGAATTATAACTTTCCAGGTGTTACATTTG
GTTGCAGTATATGAAGTTATAACCAACCGACACTTTGCTAGTATCATGAATTTCTGTTAA
CTGCATTCCAGTTGCAAGATTTTGAGTCTGAATATTCAACCACAAGTTTTAACAAGTTCT
ATTATGAACCCAAAAGTTTCCT


invisible?    
Gene introns: 0  

>23498 286 830 20106+,202669+,24727-     15q25.3    chr15:85725241-85725047 BLAT!
CAAAAGGAGGTGGCGCAGGTTCGCAAGCGCATAACCCAGCGAAAAAAACAAGAACAACTT
ACTCCTGGAGTAGTCTATGTGCGCCACCTACCTAACCTACTTGACGAAACCCAGATCTTT
TCATATTTCTCCCAGTTTGGCACTGTGACACGGTTCAGGCTGTCCAGAAGTAAAAGGACT
GGAAATAGCAAAGGCTATGCATTTnTGAAACAATGAACAACTACCTGTTTGGTGAAAGAC
TCTTGGAGTGTCATTTTATGCCACCTGAAAAAGTACCTCGGCCGCG


invisible?    
Gene introns: 0  

>5460 212 827     2q36.3    chr2:227593483-227593592 BLAT!
TTTCTCACCCAGTTCTCTGCTACTAAATCAGGCCCCTGCTTTCTCTAACACACACCTCTG
CTACAGCAGGCCTCTCCCACCTTGTGTACTTGGAAACCAGAAATTTGCAGCGGTGTCAAT
GAGAATATAAACCATCAAGAAGTCCTCAGGCTAAGCACAGTGGCTCACGCCTCTAATCCC
AGCACTTTGGGAGGCCGAGGTGGATGGATCAC


invisible?    
Gene introns: 0  

>12982 176 827     18q21.31    chr18:54047623-54047798 BLAT!
AAAACTGGAGGACTGAGGCCTCCACAGAAAAGCAGCATGAGGCTATTGTTTAAAAACACT
AACTTCGGTTTGCAAAAGACCCGGATTAAAGTCCCTGCATCCCCACCTTTTAGCCATATG
ACCCTAGATCAAGGGGAACAGCCTTTTTGGGTTCTTTCCTTATTGGTTAAACTTGG


invisible?    
Gene introns: 0  

>24749 280 827 152474+,203407-,69435-,184481-     20q13.11    chr20:41974967-41975156 BLAT!
AAGCCAGAGTCATCCTTGATGCTTCTATCTCTTCATCTATCCATTCATTTATTCATTCTT
TCCATAAGCATTTATTGAATACCTGTTAGAAGGCAGCAGACACTGCTGTGTTTACACTAA
TGAACAAGGCAGCATAATCCCTGACCTCATGGAGCTCATAGTCTAGAGAGGAAAATGAAT
ATTAACCAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAATGTAGCATGGGAG
GGGAGGTCATTGACCAAGATCCCCGCGTACCTCGGCCGCG


invisible?    
Gene introns: 0  

>13234 173 825     2p13.3    chr2:70867383-70867555 BLAT!
CTCCTTTTGTGTCTTCGCATCGTCTTTCTATAAGGACACCAGTCATGCTGGATTAAAGGC
TCATGCTACTCCAGTATGACTTCATCTTAACTAACTGTATCTGCAATGACCTTATTTGCA
AATAATAATTCAACCTATAACAGTATGGAAAACAGATTTTCTGTTCCTGGCTT


invisible?    
Gene introns: 0  

>24683 295 824 145680+,204132+,197970+     12q14.1    chr12:60859842-60859640 BLAT!
GATCCCATGACTGGTTTCCTGATCCATGGTTTGCGTAATATAAGATTTTAGAATGGGCGG
TAAGAGGTAAAAATAATACAAAAAGATAAATATATAAAATGCCAAACTCCGGCAGAACCA
TCACTACAATCAACATTGTGATCATGCAGTTTACCCTGCCAAGTTCCTTCGTGCCCCTCT
GTAATCTCTGCTTCCCACTTCTTNNNCACACACTCACTTTCCATCACTATGTATTCTTCT
GCATTTACTAGAGCATTATATAAAATTAGACAGACAGTATGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

Shown 541-570 from 1945 sequences on 19 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs