Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 601-630 from 1945 sequences on 21 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>17971 221 778     9q21.13    chr9:76089277-76089497 BLAT!
CACACATCTTCCTCAAGCTTGGCCAGATGGGGCCTCACTGGGGCCCTTCCAGAATCGGGC
ATCGGCTGTGGCCAGCTGTGTGAGGATCTCCTCCAACTCGGGTCCATCCTCTGGGAAACG
CTCAGAGAAGGATCGGATGAGGCCAGCAGCTGACGCCTCGTATTCCAGAAGCTGCACGTC
TGAGCCTTCAAGGCGAGTGTTGGGCTGAACAATGAGCTTCC


invisible?    
Gene introns: 0  

>24134 252 777 88288+,117710+,203682-,93975+     19q13.11    chr19:35239706-35239525 BLAT!
GAGCGGCCGCCCGGGCAGGTACCACTCTCTTCATAAGAGTCTTTTGATGCTCATTCCTAG
TGGCCCTCTGnAGAATATGAAGAGCTACATTACCTAGAAGGATGTGCTTCATATGCCCAA
ATGAGAGCCTAGGACAGGAGTGTTTCCTGCAGCCTGCATTATTGTGGCCTGCACTATTGG
CACTGCTACAGTGGACTTTCATTTGTCACATGACCTGTCTGACCACACCACCCAGGGGGA
GCAGGTGACTCT


invisible?    
Gene introns: 0  

>22488 216 774     15q26.3    chr15:98525843-98525628 BLAT!
GCCGCATTCAAACAGCTGTTTAAGGAAGCCCAATGATATTTCATCCATTGTCAAACTTGG
CATTGGAGCAGAATAAAGACCAAAGTAAATATTTATTGATTCATGTGAGAATACTGAAAA
TTTCTCTTTTATAAGTAGAATAAGCAAATAAACCATGATTTATAAAAACCCTGGCTAACT
AAAATCAGCTAATGGGTCTATTCAAAAAATTCTTAT


invisible?    
Gene introns: 0  

>14980 190 773     10q26.13    chr10:126970095-126970284 BLAT!
TTCAGTCAAAAAAAAAATCCATTATAGACATATGAGAAAGACAGAGCGAGGTGGTGAGGG
GAAGAGGAAGCAAATGTGGTTAAATGTTAACAATTGATGAATGTCAGTGAAAGGAATATG
AGTGGTTATCACACTTTTTAAAAAGTAAGTTTGGCATTTTCTAAAACAAAATGTAATTTC
TCGTGTTGGG


invisible?    
Gene introns: 0  

>1478 190 770     2q36.3    chr2:227593483-227593592 BLAT!
TCAGGCCCCTGCTTTCTCTAACACACACCTCTGCTACAGCAGGCCTCTCCCACCTTGTGT
ACTTGGAAACCAGAAATTTGCAGCGGTGTCAATGAGAATATAAACCATCAAGAAGTCCTC
AGGCTAAGCACAGTGGCTCACGCCTCTAATCCCAGCACTTTGGGAGGCCGAGGTGGATGG
ATCACCTGAG


invisible?    
Gene introns: 0  

>2797 187 769     16p11.1    chr16:34782847-34782682 BLAT!
CTTCCAACCTGCTCCCTACGTTTTCCAGCTCTATCTTTATATTTTGGATTCTTCAATGTC
TTTTCATCTTCGTATTCTGTATTCTGTAAACCATATTTTACTCGTATTTTCTTTAATTCT
TTTCTTCTTTCCAACTCTTTTTCCTCCTTACTTAGTGTTGGACCAACAAAAGATTCATCT
TTCTTAT


invisible?    
Gene introns: 0  

>17516 143 769     2p24.2    chr2:18973617-18973475 BLAT!
AAGACCAGTGAGAAAACATGGTGCGTTTTAGTAGCTGCATGTTACTTTATGAGGACTGGG
TTGGGTCAGAGGGGGAGTTGGGGATCTGGCGAAGAATAAGTGGCCATAGTTAAATAGCCA
GGCTGGGAGAGCTCTGTTGGCCC


invisible?    
Gene introns: 0  

>11118 215 766     5q11.2    chr5:54220972-54220758 BLAT!
TATATAGTAAAAGAAATAACAATTCCAGCACTTTAGGAGGCCAAGGCGGGCAGATCACTT
GAGGCCCGGAGTTTGAGACCAGCATGGGCGACATGGTGAAACCCTGTCTCTACAAAAAAT
ACAAAAAATTAGCCGGCTGTGATGGCATACACCTGTATTCCCAGCTACTCAGGAGACTGA
GGTGGGAGGATCAATTGAGATCAGGAGTTCGAGGC


invisible?    
Gene introns: 0  

>9 109 765     Un_gl0002160    chrUn_gl000216:75781-75860 BLAT!
CATTCCATTCCGTTCCATTCCATTCCATTCCATTCCATTACAATCCATTCCATTCCGTTC
CATTCCATTGCATTCCATTCTATTCGGGTTAATTCCATTCCATTCCATT


invisible?    
Gene introns: 0  

>2833 157 763     Xp11.4    chrX:40650710-40650554 BLAT!
CCCGCCTATCCTGCCCCTGTATAAACCCAAGACCTTAGTGGGCACACACACAAGTGGCTG
AATGTTGGGACCAGCAGACCAGCGACAGTGGAACAACGCAGCAGAGAAAGAGAGAAGAGG
AGTAACATCTGGATGCTGAGGGGAATTCAGCTAGGGG


invisible?    
Gene introns: 0  

>1418 147 758     13q32.1    chr13:97818929-97819075 BLAT!
AGTTCTTTAGTTTTGGGACTCAGACTGGCTCTCCTTGCTCCTCAGCTTGCAGATGGCCTA
TTGTGGGGCCTTGTGATCGTGTGAGTTAATACTTACTAAACTTCCCTTGATAGATAGATA
GATAGATAGATAGATAGATAGATAGAT


invisible?    
Gene introns: 0  

>6930 131 758     Xp21.3    chrX:28304861-28304991 BLAT!
TGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGTCAAGTCAGTCGGATCACCTGAG
ATCGGGAGTTTGAGACCAGCCTGACCAGCATTGAGAAACCCCGTCTCTACTAAAAATACA
AAATTAGCTGG


invisible?    
Gene introns: 0  

>21552 191 758     9p12    chr9:43313876-43314047 BLAT!
ACAGAAAGAATGTATTTGTGCCTTTCTCAAGAAAGAATAATTCAATTTCAGGCCACTCCA
TGTCCAAAAGAACCAAATAAAGAGATGATAAATGATGGCGCTTCCTGGACAATCATTAGC
ACAGATAAGGCAGAGTATACATTTTATGAGGGAATGGGCCCTGTCCTTGCCCCAGTCACT
CCTGTGCCTGT


invisible?    
Gene introns: 0  

>22413 192 758     16q12.1    chr16:49292961-49293152 BLAT!
GAAAATATTTGTAAGCCATACATCTGATAAGAGGTTAATATTCAAAATATATAAGAAACT
CAATCAATTCCAAAGCAAGAAAATAAATAACCCAATTTAAAAATGGGCAAAAGATCTAAA
TGGACACTTCTCAAATGAGGACATACAAATGGCCATTAGGTATCTGAAAAGGTGCTCAAT
GACATTAATCAT


invisible?    
Gene introns: 0  

>19590 163 756     1p21.3    chr1:96884456-96884295 BLAT!
CATTTTGTTTTCTTTGGATTCTTGTTACATGTTCGCACATAAAAAGAATTATCCGGTGGT
CGTCTCTTTTCCTTGCAGCTGGAAAGCATGCTAATAATGCTAAGACAAACTGATTGGACT
GAGAGCGCTGGGGACCAGTCTTCTGTTAGAATGGATAAACAGA


invisible?    
Gene introns: 0  

>16536 185 754     8q24.13    chr8:127194125-127193941 BLAT!
AGGGAAAATCATTTCCTGTTGCTACTCCATCACTCTGTGACCCATACTGAGCTTTCATTT
TCTTCCCAGCAGTTATCACTCCTTAAGATATGTTATTTTGTATTTGTTTATTCATTGTTT
ATCTGTCTCCTTCAGCAAGAAGTAAGCTCTATTAAGTTAAGGACTTAGTCTTGTTCTCTG
TTATA


invisible?    
Gene introns: 0  

>19189 178 754     5q11.2    chr5:52412637-52412460 BLAT!
TACACTCACTCTTTTGCTCTTTGCCTCTGGCTGCTTTCATGTGCAATAGCAGAGCTCAGT
AGTTGTGACAGAGATCACACGGCTTGGGAAGTCTAAATATTTACAGTCTGGCCTTTTACA
AAAAATTGTGCTGACCCCTGAAGTGCAGTGAAGAGTTATCTGTAGCCCAAGGGCATGG


invisible?    
Gene introns: 0  

>4321 162 752     16p12.2    chr16:23226058-23225897 BLAT!
ATATCAAGAGTTTGGCCAAGTCTGTCCTGCAAAATTCCAACAGGTGAATCAAGAGCCTTG
GCATCCTACCAGATTACCAGTCCTCAGCATGGCTGTCTCCCTCCTACCCAAGCTGGCAGC
ATGGCCAAGGCACTGAGCTCCTTGGGGATATTAGAACCTGGC


invisible?    
Gene introns: SCNN1G (23194039 - 23228200)  

>12490 134 752     2q33.2    chr2:204500464-204500359 BLAT!
CGCGGCCGAGGTACGCGGGGGGATGAAAGACGACGACTTCTTGAACAGAAAACACAAGAA
AGTCAAAAAAAGAAGCAACAAGATGATTCTGATGAATATGATGATGACGACTCTGCAGCC
TCAACTTCATTTCA


invisible?    
Gene introns: 0  

>12764 210 752     10p15.3    chr10:2756640-2756849 BLAT!
CATTGCAATAACTAGTTTAAGGATGCCATCTTGAAATAACCGACTCCTGGAATGCCATTT
CAGCTTCAAGACCAATAGAGAGCTAAATCGAGTGGTATTTCTGAGTTGACAAAAGAAAAA
TTTAATTAAAACTATAAGTGACCTTCAAATGTCAGAAGTAAATAAAACGATAACAACTAC
ATTTTTGACAGCTGTCACCAGCTAATGGGA


invisible?    
Gene introns: 0  

>16040 181 752     2p12    chr2:78564609-78564789 BLAT!
TCATGTCCCCCAGCCTCCATCCAAATCCCTGGCAAACATTAATGATTGAAAAGTTTTGCC
TGTTCCAGAATGTCTTATAATTGGACTTAAACTTTATGGAGCCTTTTCTGAATGGTTTCT
TCACTTACCAATATATATTTAAGTTTCCTCCGTATCTTTTATTTGTTTAATATCTAATTT
C


invisible?    
Gene introns: 0  

>15007 180 749     1p31.1    chr1:73874147-73873968 BLAT!
TTCCCTCTGAAGGGCTTCAGTTCATTATTCTGGCTTTTGAAAACTTACTACTATCGGGGG
AAATTCAGCCAGATATTGGGCAAAATTCATCCCCCATATTTCATGTAGGTTCTTTTTTAT
TTTCCCTAAGTGTTGGCTGGTTTGAGAAATAAAGCTAAAGAATATAAAAGAGAGAAATTT


invisible?    
Gene introns: 0  

>17823 232 749     Xp11.3    chrX:43888850-43888621 BLAT!
TAAATCTTCGATCTCGACTTCTTGAGCGGCTCCGTCGCCTCTCTTTGCTTCTACTTCGCT
TTCTTTCACGGCTTTTGCTCTTTTTCCTTTCTCTGTCTCTACTTCGCTTCCGTTCCTTAC
TTTTGCTTCTCTTTCGTTCATGACTACGACTTCTGCTCTTGCTTTTTTTCCTCTTTTTGC
TACGTTCTTCATGGCCGTTGGCACTGCTCAACTTGTTCTCATCCTTCTTGTA


invisible?    
Gene introns: 0  

>19685 175 748     5q35.1    chr5:168764274-168764100 BLAT!
CCTAGAAATCTCTTCTTCATTTACCCTTTTCCCTTGTCGAGTTAACTTCATTTACCCTTG
GTGTCTCAGCTCAACTGCTGATTAGGAACATCTTCATGGATCACTAGATTAGGCATTTTA
CTGGTTCCTTAAATTTCCTTTATATCCCATATAGCAATTTTTGTAATAATTTGAT


invisible?    
Gene introns: 0  

>21196 203 746     2q14.2    chr2:119034641-119034439 BLAT!
GGTCTATGCTCCTCATCCCGTGTTTTGCCCACCCCTACCCACTCAATGCTTTGTGCTGTG
CTGATTCAAGGAGGGAGATCAGGGTGAGCTGGAGCAGCTGAGGAAGGCTTGAAAGACCAG
GGCTGGGAGGCACACAGGCACAGTTCAAGAAAGAAAACCAGTGAAAGCCACGGCCCAGAG
TGAAGGAGTGAGTGTGTGTCCCT


invisible?    
Gene introns: 0  

>14462 144 745     16p12.2    chr16:22958404-22958547 BLAT!
TATCAATATTTCAACTTCACTATGTCTTAATATTACTCTAGTTAACCTTTATTGAGCAAA
TGTCATGTGCCAGGCTCCATGCTAAGTGATTTACATGCATTATCTCATCTAATTTTCCCA
ACCTGATGAGCTATTACATAATAC


invisible?    
Gene introns: 0  

>2956 217 743     9p13.1    chr9:40873290-40873506 BLAT!
TACTGTAGGGGCAGAGAGAAATCTTCCCCTCTGCCCTCTGATAGTTCACTGCTGAAATGA
GCTGACAATAGACAGATTAACAAGGGAAAAATGCATGCAATTTATTAATATGCACATGGA
GATGGGAGTCCTAAAAATATGAGACTCAAAGAAGAGCTTTGGTTAAGCCTTAAATGCCCT
CTAGTTGGTTAATTCTTAAATATCCTATTCACAGGGG


invisible?    
Gene introns: 0  

>6405 180 743     7q22.1    chr7:98343420-98343241 BLAT!
TTCCTTAAACTGCCACACAAAACTGTGCTTGGATTTGGTATTCAAATGATATCTTTGTAG
TGAAAATGATCACTAACGTAATATGTAACTCTAACATGAAACCTGATTTTATTGCGTTAC
AGTTCTGATTTTATTAGAACTGGATCATTTTGCCAAAACGGTATACTTTGGTGAAAGGGT


invisible?    
Gene introns: 0  

>3716 178 740     8q24.13    chr8:123740823-123741000 BLAT!
GAGGCTTTCATGGGCCTGGAAGAAAGTAAAACTGGTGCCAAAGAAAACAGCGTATTTAAA
ACTGCAGGCTTAGCTTCAACAGTGATGAAAACAAAGTGATCTTTGCTATTTACCAACCCA
TCACTCCCAAGTTGACTAATGCAAGGGCCACCATATTGCACAACTCTAGGAGGCTCAA


invisible?    
Gene introns: 0  

>11812 200 738     7p14.2    chr7:35252865-35253064 BLAT!
AAGCAATGTCTCTCCAGGGGAACTTCTAAAAATTCCAAAGCTGACACCACACTCCCATAC
CAATTAAATCACAATCTTTGGGAGTGGGAGACAGGCTTCAGTAATTGTTAACATTCCCCC
CTGGTGATTCCAATGAGCAGGCAAGTTTAGAAATGGAAGATAGGTGTGTGGATGGATACT
TTTCACCATATACTCCTGTA


invisible?    
Gene introns: TBX20 (35242041 - 35293711)  

Shown 601-630 from 1945 sequences on 21 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs