Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 661-690 from 1945 sequences on 23 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18301 228 696     12p11.22    chr12:28100826-28101053 BLAT!
TCCATTTTGCAGGGTGCTATGGGAACATGTAAGTGGGGCGCCTATCCCGTTTTGTTGGGC
TGGGGAGAGGGGTGGACAGTGCTTCATGATGTCGTAGTTCAGAATGATGAAAAAAGAACT
ATGATCCCAGGGAGCAGCTGCCAGAGAAGACTTGGAAGGAGTTTGGTAACAAGAAACCCA
GGAGAAACTACCTGATGCTTTAAATCTGTCTTAATATATGTGAATAGT


invisible?    
Gene introns: 0  

>18904 235 694     13q12.3    chr13:30502647-30502832 BLAT!
GAAGTTTCTGGGGAAACTGGATTTTATCCCTATATTTCTTTATGTATTCAGTTTAGTCTA
TCAAAAAGGAGCCCTGCAAATAAATTTTCTTCATAAAAAAAGCTGATTAGAAAAGGCCAT
TTTAGGCCAGGCGCAGTGGCTCACACCTGTAATCCCTGCACTTTGGAAGGCTGAGGTGGA
TGGATCGCTTGAGGCAAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACTCT


invisible?    
Gene introns: 0  

>18876 160 693     14q31.1    chr14:83393406-83393247 BLAT!
GAGAGTCACAGAACTTAGCCCATGAAGAGCACACTTCCACTGGCTTTGCAGTCTATCAAT
CAATCTATCTATCTATCCATCTATCTATCTTTCTACCTATCTACCTATCATCAGCACACC
TTAGCTGCTGACTCTTAAACAGTTTTGTGTATATATTTTT


invisible?    
Gene introns: 0  

>5325 220 692     11q12.1    chr11:57663690-57663471 BLAT!
CATCATCACTACTTCCATGTTCTATTTGTTACAAGTGAGCTGCTAAGTTCAGTCCATACT
CAAGGGGAGGGGAATTACACTCTATCTCTTTCAAAAAATTTGTGGGCGTATTTTAAAACC
ACGAACAAGTCCATAAGATACATTTGAAACCTTATGATAAACTCTTCTCTTGTTTAAGCT
AACTCCAATTGGATGCAGTAGTTCTTCATTTAAAAGCCTT


invisible?    
Gene introns: 0  

>21484 179 691     11p12    chr11:40584484-40584306 BLAT!
GGAAAGGAGTGATGATCGAGTAGAAAGAGCCCCACACAGAGTGCCACGCTAAGAAAGCCT
CAGTCAGACATGAGGAGCCAAGGAACAAAGATGAGCCGTTGCAGAAAGTGAAAGCTAGGC
ATGAATTGTTCGGTTCTAATACCCACTCACATACACAATTTGCTCAGCCATTGGCTTGG


invisible?    
Gene introns: 0  

>16889 187 690     7q33    chr7:137984127-137984313 BLAT!
TCTTCTTTGTTCTGCTAATGTGGCATATCACATTGATTGATTTGTGTATGTCAAACCATC
CTTCTTTCCCAGCAATAAACCCTATTTGATCACGCTATATAATCCTTTTATTGTGCTTTT
GAGTTTTGTTTGCTAATATTTAGTTGAGAATTTTTGTATCCATGTTCATCTGCATATTGG
CCTATAG


invisible?    
Gene introns: 0  

>20508 200 689     10q21.1    chr10:54303563-54303364 BLAT!
ATATGAGAACTCTTAGACTGTGCCTTTCCTGGGCTATTAAAACCTCCTCTACTTTTGACA
TCAGATTTGAAGGAAAAGTATGTTGTTCTCTCTCAACCTTCCCTACCAAATATGCCTTCT
GCCAAATTCTCCCATTTAATCAGCTAACCTCATTCTATTAAGAGAGGAGAAAGGGAAGTA
AATGGTAAACAAATTAAAAT


invisible?    
Gene introns: 0  

>5685 180 688     19q13.33    chr19:50594824-50595003 BLAT!
CACACACCTGTATCTTTTCTAAGACTGGGAGAATTTTACAATTGCTTGACTAATTGAACA
GTGCCTCGAGGATGTTACACTAGGTTATAAATAAATTCCTGCCGTGTTTAGCTGAGGCAC
GAACACAATGCCCACTGACAATTCCACTTTCCTCGAGGGCCATTCTTTATGAAAGGCTGT


invisible?    
Gene introns: 0  

>2879 171 685     6p11.2    chr6:57841081-57841251 BLAT!
TAAAATCACAACAAGTAAAGACATATCTAGGACCCTTGTCCTTCTGGATCCACGCTTCCT
TCAGGGTCTTCATCATTATAAATGTTCTCTGCCATTTGCCACACTTGCATGATATTGTCT
TCTGATACAGAACAAATCACCCAAGGTTCATTGGGATTCCAGGAGAAATCA


invisible?    
Gene introns: 0  

>12000 192 685     Yq11.222    chrY:21852701-21852892 BLAT!
CTGCAGACCAAAGCTGTTCCTATTCGGCCATCTTGTCAGCCTCAGTCTAATTTTATATTT
TTAGTAGAGACGGGGTTTCACCCTGTTGGCCAGGTTGGTCTCAAACTCCTGACCATCTGA
TCCAACCACCTTGGCCTCCCAAAGTCCTGGGATTACAAGTGTGAGTCATGGTGATAGAGG
GTGACAGTAGTC


invisible?    
Gene introns: 0  

>6280 174 680     3p22.1    chr3:39782269-39782096 BLAT!
GAATACTATAAACACCGCTACACAAATAAACTAGAAAATCTAGAAGAAATGGATATATTC
CTGGATGCATACACCCTCCCAAGACTAAACCAGGAAGAAGTCAAATCCCTGAATACACCA
ATAACAAGTTCTAAAATTGAGGCAGTAATTAATAGCATATCAACAACAACAAAA


invisible?    
Gene introns: 0  

>5956 132 678     14q12    chr14:26715837-26715706 BLAT!
TCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCCACACTGCCTGGCCAATTGTGAAC
TCTTAAATATCAGAAAAAAATATATTCTCATCTTTTTGGCTCAATATTAGTATCAGTTTT
TAAAAACTGATA


invisible?    
Gene introns: 0  

>8187 225 678     8p12    chr8:30141044-30141268 BLAT!
GCTACAACTACAGGTGTGTGCCACCACGCCCAGCTCATTTTTTTGTATTTTAGTAGAAAT
AAGGTTTCATCATGTTGCCCAGGCTGGTCTCGAACTCCTGAGCTCAGGCAATCTGCCTGC
GTTGGCCTCCTAAAGTGTTAGGATCACAGGCATGAACCATTGTGCCTAGCCTGTTTTATT
ATTTTTTTATTTAAAAAACAATTTTTGAGACAGGGTCCTGCTCTG


invisible?    
Gene introns: 0  

>15720 192 678     Xq21.32    chrX:92477668-92477477 BLAT!
CTCTCAATACCTTGGGCCCAGTCATGAAGATGGAACCTCTGAATAACCTCCAGGTGGCTG
TGAAAAACAATATCGATGTCTTCTACTTCAGCTGCCTCATCCCACTCAATGTGCTTTTTG
TAGAAGATGGCAAAATGGAGCGCCAGGTCTTCCTTGCAACATGGAAGGATATTCCCAATG
AAAATGAACTTC


invisible?    
Gene introns: 0  

>15117 197 674     2q22.1    chr2:138159488-138159292 BLAT!
GTAAGCATCAGTAATGAACCAATAGCTCAGATATGGTGAAGACACATTCACTGAATTAAC
AGGGCTGTGCAGAGCAAATCAGTTTGTTTTTCTTTATAAATTGGTATTGTAAAGTAGTTT
AATGGAGGCATTTGGGTTTTCTAAATGCCAACAAATGCATGCAAAGTTAGGACATGATGT
TTGACAGCACCCACATT


invisible?    
Gene introns: THSD7B (137748461 - 138435287)  

>23851 299 674 55305-,203241+,129657+     8q24.13    chr8:124300860-124300968 BLAT!
CGCGGCCGAGGTACGCGGGGGAGGTGGAAAAGCAGTGGCCAACTATGATTCAGTGGAAGA
AGGAGAGAAGGTTGTGAAGACAGCCCTGGATGCTTTnTTGTGGTCAACAATGCTGGAATT
CTGAGGGATCGTTCCTTTGCTAGGATAAGTGATGAAGACTGGGATATAATCCACAGAGTT
CATTTGCGGGGTTCATTCCAAGTGACACGGGCAGCATGGGAACACATGAAGAAACAGAAG
TATGGAAGGATTATTATGACTTCATCAGCTTCAGGAATATATGGCAACTTTGGCCAGGC


invisible?    
Gene introns: 0  

>5537 167 673     12q21.31    chr12:81182907-81182741 BLAT!
CTATCAATCTTCCAATTACCTGTTTCATTGTTCTAAGCAGTTGTTAAGTAGGCACCAAAG
TGGTATTTCTAAAGGCACAATTCTTACGTGAAACAAGATTTGTATTTCAAAAGCACAGAG
CTAAAAGTTTAGGCCTACATATTGTATCATTTGCTCAAACCAAGGAA


invisible?    
Gene introns: 0  

>17714 194 673     2q36.3    chr2:230955767-230955573 BLAT!
CACTGAGTTTTTGTTAGGATGACCCTAATTCCCCCTTGAATTCAGAAGAGTAGAAAAAAA
CTTCTCACCTCCCAAGCTTGGGGGAAGAGAGCTCTACCTCCTCCCACCTTTTGGATGTGC
CCCTGAAATGGCTGTTTTCACTGCCAGGTCATTTTACAGATACCTCCAAGCCTGTTCAGC
AAGAGGCTGGAGGG


invisible?    
Gene introns: 0  

>3632 210 672     12p13.32    chr12:4357557-4357348 BLAT!
CTTCATCACACAGTCTTGTGCGTAGCAGGCTGCCCAGTGTCCAGCTTTGTCCCGTTACTG
TGCATCTTCCTTGCATCCAAAGTATACAGGGAAGCTGACCCTCCCAGTCAGGCCTCTCCA
CCTGGTCCTCAGCTGCCGTCACAGATGTTTAATCATTGATCCCTCTTTTGGATTTCATTG
TTATTGCGTTTTCCTTTTATTATGGAAACG


invisible?    
Gene introns: 0  

>2646 160 671     2q12.3    chr2:108357257-108357416 BLAT!
CAAGTAACACAAAGCAGGGCCACTGGAAGGCTGCAGTATATTTGGCATAAACACACCAGA
ATGTCACAGATTGTAAGTGTAGAGTAACCCAACTAAGTTCAGAGCCCACACATGCATAGG
TCCAAGTCTGCTAAAACACTGCCAGACTTGGCAAATTCTG


invisible?    
Gene introns: 0  

>14443 173 670     14q21.2    chr14:43770320-43770493 BLAT!
CACAAAAATACCTTGGTATACATTTAACCAAAAATATGGATTCAACCTAAATATCCCTCA
ATGGATTATTGGAAAAAGGAAATGTAATATAGCACATACATAAACACATACACAAACACA
CATACACCACGGAATACCACTCAGGGGCATAAAAAAATGAAATCATGCCTTCT


invisible?    
Gene introns: 0  

>16857 178 669     6p24.3    chr6:10026263-10026086 BLAT!
TTGGACAGACATGATTCTGAAACTGATATGCTTCTGATGCAAGACAAATAAGTCTTTCCA
AAAGAGAGGAATCAGTTTTGTTAATTTAGTTATAAAAACTGTAGAAAAATGATTTTTTGG
TATTTGATTTAGTTACTAAAAACTTGTAAGATTATTGGAAAAACATGGTTATGTGAAT


invisible?    
Gene introns: 0  

>7216 168 666     4p15.1    chr4:31264276-31264443 BLAT!
CAACAAAGAAATATGTGTTCATGAAAAGCTTTTAGTAACTAAAAATGATTAGTTAAATTT
AAAAAACAAAGTTTTGTAAGAACTGGGATACGACCCAAAAAACTGTTAGATCAAAATACA
TCAGTTTTAAAATACCTATAAAGGAGCAGGAGATCCAAAAGCCATCGA


invisible?    
Gene introns: 0  

>11879 174 665     19q13.11    chr19:35240264-35240091 BLAT!
GATGACTAGCCTACAAGCCCACAAGATCAGAAGCACCAATCCACAGTCAGAACACAAAAC
CTCAGTATCTGTGGGATAAGGGACTTATTGCCCACCCTGGCTCCAGAAATATGCACCAGA
ATGACATTCCCATCCCCAAAGCTGCTTGCCATGGAGCTGGGAGTGAGGAATGTG


invisible?    
Gene introns: 0  

>18232 164 664     5p12    chr5:45401005-45400842 BLAT!
ATTTTTGTGGGAAAAAAAGCCAGAATCATGGATTTGTGTATGTGCATGTGTGTGTGATTA
TATGAACATGGAGAAAGGCACAGAATGATCCATACCTGATTTTGGGGAAATGTAGGTAGA
GAAAGAGGAATGGAAACATGTGAAGAATGGAAAATAGAAAAGTT


invisible?    
Gene introns: HCN1 (45259351 - 45696220)  

>19284 182 664     3p25.3    chr3:10287476-10287296 BLAT!
CTCAAAACAAAAAAGAAGAAAGAAAACAGGTGTATGACCAGCTGGCCTGGTGGCTCACTC
CTGTAATTTCAGCAAGACTGTAATCTAGTTTGTCTTGATAGATTTGCCTATTCTGACAAA
ATTAAAAATGGAATCATACAATATGTGACTTGCTTTTTTCTTACCATGATCTCAAGGTTC
AT


invisible?    
Gene introns: 0  

>3543 231 663     10q11.23    chr10:50424285-50424515 BLAT!
TTCTGGAAAAGGAAAACTATGGAAACAGTAAAAAGATCAGTGGTTGCCAAGGGCTGGGGA
GAGGGAGGAATGAATAGGCAGAGCACGGAGAATTTCAAGAATTTTTAGGGCAGTGAAACT
ATCCTTTATGATACTATGATGGTGCCTATATGTCATTCTATATTTATCAAAACCCACAGA
AGGTAAACACCAAGAATGCACCCTAATATAAACTATGGACTCTGGGTAATA


invisible?    
Gene introns: 0  

>4823 169 663     4q35.2    chr4:190664139-190664307 BLAT!
GGGCTGTTATCCAGAATTGGGAGACCTGAAGACAAATCACAGCACAGGACTTTTTGCAGA
CATTCTGCAGCACCAGCCTGGAGCCCAGTAGCCCCACTGGGTGTCTAGACCCAGAAGGGC
ATTAGCAATCACTGCAATCTGGCTCTCAAGAAGCCCTATCCCTAGAGGA


invisible?    
Gene introns: 0  

>24424 211 663 116834+,202502-,10205-,168047-,60529-,75191-,66290-     3p14.1    chr3:69205487-69205628 BLAT!
GCATCCATAGTCAAATGACTCATTTTCTCTCTGTGTCTGTGTCTGTTAGTGCATAATTTT
ATTTCAGAATTCTAAATTGCCTTCAGATTTGGACAAATTTTCCTCTTCATTTGGTGTGTA
TTATAGTTGATTTGTGTCCCCnTTTTTTTTTTTTTTCGAGACTGAGTCTTGCTCTGTCAC
CCAGGCTGGAGTACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>6504 119 661     1q41    chr1:217603078-217602960 BLAT!
TCTGCCTCAGCCTCCCAAATAGCAGGGATTACAGGCACCCACGACCATACCCGGATAATT
TTTGTATTTTTAGTATAGACGGAGTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCT


invisible?    
Gene introns: 0  

Shown 661-690 from 1945 sequences on 23 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs