Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 691-720 from 1945 sequences on 24 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>9128 222 658     22q11.1    chr22:17352332-17352111 BLAT!
CTCATCAACGAGAAGACATACCATAATCAACCTCACCACTAACGCTTGGAATATCTAAAC
TTAAAAATGGTCCTTCCTTTCCCCTTTACTTGTATTTAAAGAACCTGACGAATTATTCCT
CCTCTGCTAAACTTTTCACAATTTCTTCAACCTCATTTATGTTTCACATTTTCAGAACAT
ATCTTGCCATTTATTAGGAATCTCACAATTAGGCACTCTCAT


invisible?    
Gene introns: 0  

>16285 165 658     3q24    chr3:148686925-148686761 BLAT!
ATTTGGGCCCATAGAACTGAATATCATATATGAGCATAGGTTAGGAATGGGTTTTGTTCT
TTTGCTATAAGGAAATAACCATTTGGTTTATAAATGACTCCAAATTTTAACAAAACAGCT
ATTTCAGATGCAACCAATAGGTTTATTTTGGCCCAAAGAAAGATT


invisible?    
Gene introns: 0  

>8265 167 657     1q31.3    chr1:194094984-194094818 BLAT!
GCCTTGGCCTCCCAAAGTGTTGGGATTACAGGAGTGAGCCACCGCACCTAGCCAGGAGTA
TTCTTTAATTGCAGACTCTCCTTCTTCACTTACAATTTATAGTTGCATTACTCACCGTGG
GCTAACATATATGGAAGTATGCGCTTCACAGATTTGACTTGGTTGGT


invisible?    
Gene introns: 0  

>17631 116 656     1p31.1    chr1:73874172-73874287 BLAT!
ATTCTTCATCTGTTTTTACTCAGTATGTGCAAAATGCAGCTTGGAAATTGAACTGTATGA
AAATTAAGAAGAAAGCAACAAGCACACCTAGCACCCAGAGATTGGTTTCTAATACC


invisible?    
Gene introns: 0  

>4984 217 654     5q12.3    chr5:66544836-66545052 BLAT!
TTAGAAACCTTAGGAGACTTAGTTTAAAAAGTATTAAAAGGTCTCATAAAAGAGAATTGT
AAGGTTGGCTAGCAGTTGATTTGTTATGAGATGGAAGAGTCATACATTATCTTGGTATTT
AATCAGTTAATAAATTGTTTCAATATGGTATATCCTTTTTTTCTTAAAGCAGTTTTCTTC
CTAATAGCAAAGGATGCCAAGATTATTGCAATCTTTG


invisible?    
Gene introns: 0  

>13862 190 652     12q24.21    chr12:115326623-115326434 BLAT!
TAACTTCCATCAATAACCATCTTAGTTTCTTCTTCCATAGGTCTAGCTATATGACCTTGA
ATAAGTAACTTAACACTCCTGAACATCAGTTTTATTATGTTGGCACAGAATATGAGTTTA
AGAACTGTGATTCATTCATTCAAATAATATTCACTAACCTCATCTTCGGGTGCTGGAAAG
ATGCCAGGTG


invisible?    
Gene introns: 0  

>16187 154 652     8q22.3    chr8:102285554-102285707 BLAT!
AGAATCCCTAAGTCTAGCTGGGAAGGTGACTGCATCCACTTTTAAACACGGGGCTTGCAA
CTTAGCTCACACCCCACCAACCAGGTAGTAAAGAGAACTCCCTAATATGCTAATTAGGCA
AAAACAGGAGGTAAAGAAATAGCCAATCATCTAT


invisible?    
Gene introns: 0  

>6299 261 650     8q12.3    chr8:63023298-63023538 BLAT!
TCAACCCGAACTTTCAGCCCCCCAAACGGCCTTTCAAACGGATGAACTATTCAGATGCTA
TCGTTTGGCTAAAAGAACATGATGTAAAGAAAGAAGATGGAACTTTCTATGAATTTGGAG
AAGATATCCCAGAAGCTCCTGAGAGACTGATGACAGACACCATTAATGAACCAATCTTGC
TGTGTCGATTTCCTGTGGAGATCAAGTCCTTCTACATGCAGCGATGTCCTGAGGATTCCC
GTCTTACTGAATCTGTCGACG


invisible?    
Gene introns: 0  

>8071 176 649     9p24.1    chr9:7613496-7613321 BLAT!
TTAAGTAGGCAAAAGAAAATGGAACCCAGTATACATAAAGAGGGGCTTACCTTACAAGGC
ATATGATTCACTTTACCAGTGGGGAAGGTAGAGTAGATGAATGCAAATACAGTCACAATA
GTGGATTTGTTGTCCAGGGGCATATGAAGTCATTCTTTTCTCATTTATTTTATATT


invisible?    
Gene introns: 0  

>13744 219 649     Xp21.2    chrX:29497215-29497433 BLAT!
TTTTAAATGAACAAAAGAATATTCAGCATCAGCTGGGCTCTGTGGCTCACGTCTGTAATC
CCAGCACTTGGAGAGGCCAAGGTGGGACAATCACTTGAGCCCAGGAGTTTGAGACTAGCC
TAGGCAACATAGGGAGACCATGTCTCTACGAAATACAAATAAAAATAATTAGCAGGTGTG
GTGGCACGTGCCTTGTGGTCCCAGCTACTCGGGAGGCTG


invisible?    
Gene introns: IL1RAPL1 (28605680 - 29974017)  

>11833 185 645     14q22.2    chr14:54676310-54676126 BLAT!
GGTAAAAATCCTTGATCCTAAACATACTTTCCTCCCATCTTTTAACATGTTTAATTTCAC
TTTAGAAGGTGGCCAAAATTCAGCCTCCAGTCCCCAAACTCCCTTCCTAATATGCCCTTC
TACCTAGAAATTCTACTTTTCTTTCTCACTATAGGAGCTCCCCCAGCCCGTGGTCTTCCT
AAATT


invisible?    
Gene introns: 0  

>24690 186 645 146248+,204000-,127141-,142380-     1q23.1    chr1:157029448-157029326 BLAT!
CACTGTAAAGATCTGGAATATGAAGACCACAGAATGTTCAAATACCTTTAAATCCCTGGG
CAGCACCGCAGGGACAGATATTACCGTCAACAGTGTGATTCTACTTCCTAAAAACCCTGA
GCAnGTGAATGGATCTACTGTGTAGGGGAGGACTTTGTGCTCTACTGTTTCAGTACCTCG
GCCGCG


invisible?    
Gene introns: 0  

>18146 240 643     2q14.1    chr2:114416149-114416388 BLAT!
GGTTGCTGCAGTCTGGTCAGATCCCTGGCAGAGAACGCAGATCAGGGCCCACTGATGATG
GTGAAGAAGAGATGGAAGAAGACACAGTCACAAACGGGTCCTGAGCAGTGAGGCAGATGT
ATAATAATAGGCCCTCTTGGAACAAGTCTTGCTTTTCGAACATGGTATAATAGCCTTGTT
TGTGTTAGCAAAGTGGAATCTATCAGCATTGTTGAAATGCTTAAGACTGCTGCTGATAAT


invisible?    
Gene introns: 0  

>215 120 642     2q32.3    chr2:196200715-196200596 BLAT!
TTACTCTTTTCACATGCCTTTCTAATTATGCCTGAAAGCCCCACTCCTTTGTTAGGGAGA
GACATCCTAGCAAAACCAGGGGCCATTATACACTAGAATTAGGAGAAGGAAAAAGGGTAA


invisible?    
Gene introns: 0  

>14274 223 642     10q11.21    chr10:45115714-45115936 BLAT!
GCACACAGTAGCACATCAGCAAATGTCTGCTGAATCAACAAATCAACAAGGCTACTGCTT
AGATTCCGTGACTACTGGAGTAAAGGAGACATAAATGAAAGCCGAGCAACCTTTCCGTGC
CTAGTAGAGGGAAGGCAGTAAGATTTTTCCCATGAACCTAATGGTTGGACTCATTCACAT
TAGATTTGCTATGAAATAGACTCAATGCTCTCTCGAAACTTTA


invisible?    
Gene introns: 0  

>3581 158 641     19p13.2    chr19:8751901-8751744 BLAT!
CTATGGTTGCAATCCATAGGGTAGTTTGTTACACAGCAAAGGCTAACAGATACAATGTGT
AAACACACTCTCTTTGGAAAGAGACATAGCCACTAATTCCCCAACAATAACCACACAGGC
AAAGACATGCATGTGATCACCATGTTTCAGTGCTGCAA


invisible?    
Gene introns: 0  

>12681 130 640     3q12.3    chr3:102426146-102426017 BLAT!
ACACAAGCATGCCCACAAAGGGTAATAAAATGGCATGTGTGCAGGCCAGATGCACCAACA
GCAGGTTGCTCTACATGTTGCTCTACATGGGGCCAAGGCCTACATGCATTACTCCGTATG
CCTTTTTTTT


invisible?    
Gene introns: 0  

>9138 163 639     12q22    chr12:95122911-95123073 BLAT!
GTAGGGAGCATGCCAACATCTCTCCTGCGAAGGGCAAGCGGAGATACTCACATCCCCAGA
TTAACATGGTATTAAGTGCTCAATTCAAGCCAAGATAGACTCTAAGGTCCAAAGGCAAAT
GAGGTATCCAAGAAAGGAAGCAGAGGTCCCACGGGGTGAGGGG


invisible?    
Gene introns: 0  

>12187 170 639     12p13.2    chr12:10888658-10888489 BLAT!
CTACTCAGAGTCTTTATTAGTCTCAGAGAACTTGGAGTCTCAGATAATGGAGTAGCCATG
TGGGGCTTACACAGAGATATGAGGTTTTTTTAATTGGTGGGAAACAGTGAGTTACTCATT
CAAACCAAATCTTCAGTCAAGCCTCTTCATCCTTGAAGCCATTCCATTTC


invisible?    
Gene introns: 0  

>18083 160 639     4q13.2    chr4:69307448-69307289 BLAT!
ATTTGACTACTTCTACCTCATCTTCGAATACTAGATCTTACTTCACGCCACGATGGGCCT
TCTGTTTACTCTTGAACCCCTGAATTCAGTTCTGCCTCCTGGCCTTTATTCTGCTGTTCC
CACTTTCTAGAATTCATTTCCTGTTGATTTTCCCAGCATT


invisible?    
Gene introns: 0  

>18674 193 635     1q21.3    chr1:152887310-152887502 BLAT!
GTGCATAGTTATATTTCATTGTTTCAATTTGCAATTTTCTTATACATGATGTTAAGCATA
CACTCATATGTTTTTTGCCATCTTCACATCTTCTTTTATGAGATGTTCAGATCTTCTGCC
CACTTTTTTAATTGAGTTGTTCATTTTCTTTCTGTTGAGTTTCTAAAATTATCTTATATA
TTGGGATTATCAG


invisible?    
Gene introns: 0  

>21338 190 635     8q21.12    chr8:78673053-78672864 BLAT!
AAATGCAAAAATATCTAGCACTCAACAAAGTCAAATTCACAATGTCTAGCATCCAATCAA
AATTATCAAACATTCAGAAGAACAAGATAATGCAGTTATTAATCAGGACAAAAATTAATG
AATTGATCCAACTGTAAATCAAATGTTAAAGTAACAGATGAAGACACTAAAACAGTTATT
AGAATTGGAT


invisible?    
Gene introns: 0  

>19412 182 634     11q13.5    chr11:76331184-76331347 BLAT!
CTGGGCAACAGAGTGAGACCCTGTCTCAAAACAGAAAAGGACCTATCAGCCCCAAGTGGA
GCAGAACAGAGGGATTTGGGAGGAATGTCCTCAGAAAAAGATATTAAAACACAGTTATCT
GATGAGTTTGAAGATGTAAAAAGTTCTACTGAAAGCCATTGTACTCCGCTCACTTTCGGC
GG


invisible?    
Gene introns: 0  

>3326 160 633     4q28.3    chr4:136538424-136538265 BLAT!
AATGAGGAAGGTCACAGAGGCTAAGATGTGAATAGTGGTGTGGTGGATGGGAGGATGGAA
AGCATTTCTCCTATCAGACAGTCCTGCAGCAGGAATCCCCTCAACCTGCTCCTGAGAATA
TGGGGAGAAAACCAGATGCCTGCAAGAGCCTTTTTTTTTT


invisible?    
Gene introns: 0  

>19078 170 633     17q25.3    chr17:75988305-75988136 BLAT!
CCCGGCCGGTTTTGCTTAATCTTAAGATAAAACTTAGAAAATCAAACAATCCTCCATAAA
TACCGAGTTCCAACTGCAAAGATACTAGGGCAGCAGACAGTGTGAAGTGACAGTCTTTGG
AAAAACTAATGGTAGCAAGAGCTGTCATTTACTCAGCACTGGGCTCGGAA


invisible?    
Gene introns: 0  

>4845 179 632     13q31.3    chr13:90687240-90687062 BLAT!
TGAGCTCATAAGACAGTATTTCAAAAATTGTATGATGCAGTTAAAATAGTATTCACAAGG
AAATGTGCAGTCTATATTACAAATCTAAAGTTAATAATCAGGGTTTCTAAGTTAATAAAA
TAGAAAAATAAAATTAAAAATAAACCCAAAGAAAGCGGAAGAAATAATAAAGATCAAAG


invisible?    
Gene introns: 0  

>21495 167 629     5q35.1    chr5:172463134-172463300 BLAT!
CGCCCTGCCATCATACTATTGTTGAAATGTGGGAATGACGAAATCAGCTCAGGTTTTATG
AGAGGAAACTCGGTAAATTCCCTTTGCTCAGGAAGTCACTTCACCCTTGAGCCCTAGTTG
TTTCATTTATTAAATTCTTGAGAAGGTTCAGTGCCATTAATACCTAA


invisible?    
Gene introns: 0  

>22943 144 628     4q21.1    chr4:77265915-77265772 BLAT!
AAGCCCAGCATAGTCTGTTGTTTCAATAAGAGTGTCATGTAGCCACACAAAGTCTTCATG
TTGCCTTGTAACAGAAAACTCTGGGCTCTGAAACGTGGGCAGTGTGGTCTTTGTGTGCAC
TGTAAATTTGACTTTGTCTCTCTC


invisible?    
Gene introns: CCDC158 (77234191 - 77328458)  

>3692 234 626     9p22.2    chr9:17831910-17832143 BLAT!
AGAATGGAGAGACAAAAATCCCCGTTTTCAGCGTTTCCTCAGCATCTCAGGGGCAGGAAG
CCAGAGACACTTATCCAGGCCTAGTTGTCCTTTCCTTGGGAATGATGTTGGGGTGGGAGG
TGGTAGTTGTTCATGGATCTCAATGGACTAAGTTCTCCTCCTAAATATGTATATTCTAAT
CCTTGGTCTCAAGGTCTCTGATGCTGTTTCTAGGCTCTCACCTGGCCCAGGTGG


invisible?    
Gene introns: 0  

>4374 238 626     5q35.2    chr5:174174113-174173876 BLAT!
TGGCTCACACCTGTAATCCCAACACTTTGGGAGGCTGAGACAGGAGGATTGCTTGAGCCC
AGAACTTCAAGACCAGCCTGGGCAACATAGGGAGACCCTGTCTCTACAATAAATACAAAA
ATTATTAATAGCTGAGTGTAGTGGTGTGCACCTATGGTCCCAGCTACTTGGGAGGGTGAG
GTGGGGGGAACGCTTGGGCCTGAATGGTCGAGGCTGCAGTAAGCTACCACTGCACTCC


invisible?    
Gene introns: 0  

Shown 691-720 from 1945 sequences on 24 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs