Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 721-750 from 1945 sequences on 25 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11774 167 626     2p22.3    chr2:35879213-35879047 BLAT!
GTCTAGTTTTGCTTTGGACTCCACTCCAAGCTGGAAGCTTTCCTTATCACTAGATAAATA
GGTTGGAACAAAATCCCAAGAGTAAAATATGCTATTTCCAGAACAAAAAGAGGTATTCTA
AGCATTGTTTCTTTCTTATTACAGGAAAGTATAAAGTCAAATAATTT


invisible?    
Gene introns: 0  

>6746 139 623     18q22.2    chr18:68692262-68692400 BLAT!
GATAGATCAGCTGGCACCACCCAGGTTATCTGATCTCTTGGCCGCCACCGCCACCGAGGA
ACTGACAAGAAGACAGCTTCCACTCCTGATGATTTCATCCGTGACCAATCAGCACTCCTG
GCTCATTGGCTCCCCCTAC


invisible?    
Gene introns: 0  

>18299 243 622     3p24.1    chr3:28027444-28027202 BLAT!
TTGCAGATGACCATCTTCTCTCTGTGTCTTCATTCACAGGCTCTCTCTCTGTGTGCCTGC
CCTAATCTCCTACTCTTATAAGGACACCAGTCATATTGGATTAGGCCCAACCATATGGCC
TCATTTGACCTTAAATACCTCTGTAAGGACTCATCTCCAAATACAGTCACAGTGTGAGGC
ACGGGAGCTTAGGATTTCAACATATGAATTTGGGGACAGGAGAGGAAAGGCAAAATTCAG
CCT


invisible?    
Gene introns: 0  

>6508 203 619     7q21.11    chr7:81098487-81098285 BLAT!
TTCCCTACAGTCTGCAGCTTCAGGTTAAGCATTTTCTCCTCTCAAGTGCATCTCCAGACT
TGAGTCTGGGGACCCTTTTCTGCCACTCCACCTTCCTCCCTTTATGGTTCCTCCCCAAAA
TTCTTGGCCCTATGGCCACCTCTATGTTTAGCATACCCTCTCGAGGAACTCAACTAGAAT
AGTGACTTGTGTGCCTGTATTCA


invisible?    
Gene introns: 0  

>18324 175 619     12p12.3    chr12:16929241-16929067 BLAT!
CAGATAATGTCAGCCTTCCAACTGTGATTTCCTTTTTCAAAATTATTTTGGCTATTCTAG
ATCTTTTGCGTTTCCATTTAAATTTTAAAATCAGCTTGTCAACTTCTACAAAAACAATTG
GTCAGATTTTGATTGAGATTATGTGCAATCAATAGATCAATCTGGAGCAAATTGG


invisible?    
Gene introns: 0  

>21321 180 619     2q31.1    chr2:174931370-174931549 BLAT!
CTACATTCAAAACAGTTTCTTGATTCCCGCCTCCGCACACACTCTCACACCTGTTTGACT
CCCAAGTCTTTCCCATCTCAGTCAATGGCACCACCATGCATCCACGTGCTTAGGCTAAAA
ACCTACAAATCATTCTTGATTCTTTCCTTCCCAACTTGCATCCAGCCCATCAATATGTCT


invisible?    
Gene introns: 0  

>21169 179 618     10q23.33    chr10:95847012-95846834 BLAT!
ACCTCAGCCTCCTGAGTAGCTAGGACCACAGGTGCAAGCCACCACACCTGGCTAATTTTT
TAAAAAACTTTATAGCAACAGGGTCTCACTATGTTTCCCAGGCTGGTCTCGAACTCCTGG
GCTCAAGTAATCCTCATGCCTTGGCCTCCCAAAGGGCTGGGATTACAGGCATGAGCCAC


invisible?    
Gene introns: PLCE1 (95753745 - 96088148)  

>1277 187 617     10q23.33    chr10:95847005-95846834 BLAT!
CCTCCTGAGTAGCTAGGACCACAGGTGCAAGCCACCACACCTGGCTAATTTTTTAAAAAA
CTTTATAGCAACAGGGTCTCACTATGTTTCCCAGGCTGGTCTCGAACTCCTGGGCTCAAG
TAATCCTCATGCCTTGGCCTCCCAAAGGGCTGGGATTACAGGCATGAGCCACCGTGCCCA
GCCAATG


invisible?    
Gene introns: PLCE1 (95753745 - 96088148)  

>125 141 615     8q22.3    chr8:102285568-102285708 BLAT!
TAGCTGGGAAGGTGACTGCATCCACTTTTAAACACGGGGCTTGCAACTTAGCTCACACCC
CACCAACCAGGTAGTAAAGAGAACTCCCTAATATGCTAATTAGGCAAAAACAGGAGGTAA
AGAAATAGCCAATCATCTATC


invisible?    
Gene introns: 0  

>13722 142 615     10q22.3    chr10:81652184-81652047 BLAT!
AAATTTTCCAATACACTAACTTTGAGAAAAATAGAAATTACATCTTATCAACTCAAGATC
GCCTTGTAGGGGGATTTGCCAAGTGGCCAGACAGTCATCCAGATGCTTTGCATGCATACT
TTGGGATCTGTGGCCTGTCACT


invisible?    
Gene introns: 0  

>15448 152 615     6q13    chr6:70186342-70186493 BLAT!
CAAGAAAACAGAGAGGCTGCCTTTGGACACAAAAAATCAATAAAATAGCATGCATATATT
ACAAACAATAAAAATAAGTTTTACCTTTCTGTATTAAGACTTTTTTTCTGTAAGCAACAT
TTCCAGATTGCTTTCAGGTAACAAATAAAATA


invisible?    
Gene introns: 0  

>3700 130 613     12p11.22    chr12:28041457-28041567 BLAT!
CGCGGCCGAGGTACGCGGGGACCAGCCTGGGCAACATGGCAAGACCCCAACTCTACAAAA
AATACAAAAATTAGCCAGATGTGGTGGCATGCACCTGTAGTTCCAGCTACTTGGGAGGCT
GAGGTGGGAG


invisible?    
Gene introns: 0  

>4526 150 613     10q26.13    chr10:125993864-125993715 BLAT!
ACTGTGCTCTAGCTGCACTGGTCTATTTTTGTTCCTCCAATCTGCTAAGCTCTTTCCCAC
CCAGGACCAGCTGATATTCCTCCTTCTGCCTGGGATACTGTTCACTTCCATCGCTCTTTG
CTTGGCCAACTGCGGCTCATTGTTTACTTT


invisible?    
Gene introns: 0  

>18837 140 613     8q24.21    chr8:129189014-129189153 BLAT!
CGAATGTTTCTGACATTGAGCAATGACATGGCTCTGCCAGGTTTAGGTCTGTCTGATTGG
AATGCAACCCGAAAGGAAAGTCCCGGAATGATTCAAACACTCACCTCCCCACAACCCCTT
CTTGGTTTTTTTTTTTTTTT


invisible?    
Gene introns: 0  

>9505 201 612     4q25    chr4:111799952-111799759 BLAT!
TATTTAGTGGCAATCATTTTTCACGTCTCTGATCAACTCTGTCACCTTTCTCTAATATTT
CAAAGTATTTCATGACTCTAGTATTTCAAAGTATTTCAGACTTTAGGGAAAGTATTTCAT
GACTCTCCTTAAATCCCCTTTCATATCTTTACTCCCTTCATACCAGGAGATGACACAGTC
TCCCACTTCAAAGAGGAAAAA


invisible?    
Gene introns: 0  

>24495 209 612 125127+,203530-,78582-     10p14    chr10:9277963-9277818 BLAT!
AGTCTGAATTTAACTTTGGAATAATTTGGATAAATACTCATTTAAAAATAAAAATTAAAA
TAAGACAACAAACAGACATGCATCAAGCCTGCATTCTCTTTTGGGTCATAGCTTGTTTAC
ATTTATACATCACTATAGCCCCTGAATnTTATTTGCAGGTTTCTTAAAATGGGGTGCTTT
TGCTGATCATAATTGTACCTGCCCGGGCG


invisible?    
Gene introns: 0  

>19297 170 611     1q23.3    chr1:163803829-163803998 BLAT!
GAGAGCAGAGACTAATAGGCTTTTACAGACATTTACACAAGCTAGAAAAATAGTTGAATT
CTTTCATCAACCATGCTATTATCTATATATACCTGACAGTGCCCCAAATTCTGCATTCTT
AGAGGTAAAATTAGGCCTTTGTCTAGTGAACTCAGATGCTCCTGAAGAAA


invisible?    
Gene introns: 0  

>651 125 610     18q12.2    chr18:36533456-36533580 BLAT!
GGGAGGCTGAGGCAGGAGAATGGCGTGAACCCAGGAGGCGGAGGTTGCCGTGAGCCGAGA
TCGTGCCACTGAACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTTAAAAAAAAAAAAA
AAAAA


invisible?    
Gene introns: 0  

>12688 228 608     2p25.1    chr2:7991538-7991765 BLAT!
GCCCAAAATGACAGCTACAATTTTCTTATTTTAAACATAATGCAGACTAAACATGAAATT
TGGAAAGCACAAAAGAATGAAAAAAAACTTGTTAAGAGATAGATTACTGAGATTATTAAG
AAACATATAAAGATATAGATATTAAATGGGCATAGCTTATTAAGGGAGATTTAAAAGAAT
ATTCAGGTCATTTAGTTTTTGAATTTTTTTCCATGTTTCAGTTTGTAG


invisible?    
Gene introns: 0  

>11500 174 607     12p11.21    chr12:31533476-31533303 BLAT!
AAAATAAAAAATAAAATAACAGCAGAGAAGAGGGATTGAAAGTATAGTTGGGGCTGCTGA
CTACAATTAATGGGTTGCTAGGGAAGGCCTTACTGAAAAATGGAGTTGCCTTTAACTGAG
ATTGGAAAAGCTGTAAAAGAAAACAAGTTTGGCTGGGCGCAGTGGCTCATGCCT


invisible?    
Gene introns: 0  

>17011 177 607     8q23.3    chr8:116240508-116240332 BLAT!
TTATGTGATGGATTATGTTTATTGATTTGCATATGTTGAACCAGCTTTGCATCCCAGGGT
TGAAGCCAGCTTGATGGTGGTGGATAAGCTTTTTGATGTGCTTCTGGATTTGGTTTGCCA
CTATTTTATTGAGAATTTTTGCATCGATGTTCATTAGGGATATTGGCATGAAATTTT


invisible?    
Gene introns: 0  

>17147 158 607     Xq21.31    chrX:90219535-90219378 BLAT!
ATTGTGAATGATGAATGATGCAATGATTGTGTCTAAGGAAAGCATTATTGTCTGATTCAC
ATTGCAAGTAAAACAAATGCTAATTTACTATGCATCACTGCTATTGTTGTCAGTGGGCCA
GTTCAAGTTCTTGATTTAACCGCACAAAACAATTTGAG


invisible?    
Gene introns: 0  

>19711 194 607     3p26.1    chr3:4024179-4023987 BLAT!
CAGGTTCCATTATCAAAACGAGCAAAATTTGTTGGACCTGGTGGCTATAACTTAAAAAAA
CTTCAGGCTGAAACAGGTGTAACTATTAGTCAGGTGGATGAAGAAACGTTTTCTGTATTT
GCACCAACACCCAGTGCTATGCATGAGGCAAGAGACTTCATTACTGAAATCTGCAAGGAT
GATCAGGAGCAGCA


invisible?    
Gene introns: 0  

>15673 154 606     1p12    chr1:118995929-118996082 BLAT!
AAAATCAATGTAGACAAATCAGCAGCACTGCTATAAACCAATAGCAACCAAGCTGAAAAC
CAATAAAAAACTCAACCCCTTTTACAATAGCTGCAAAAAACAAAAACAAAACAAAAACTT
ACAAATATACCTAACCAAGGAAATGAAAGATCTC


invisible?    
Gene introns: 0  

>5652 195 604     4q35.2    chr4:189299964-189299770 BLAT!
TAAACTCTCATTCCCTGAATATTTTTCAAAAGAAAAGAAATAGGGTGAAAGACCTTGGAA
ATGAGTCCCTTGGTGAATGAGTGCCCCGTGGGAGGAAATATGAAGATCTAGTGCATTATT
TTGTGGTAATTAAGTTATGCAGTAGAGGGGCTGGGCATAGCGGCTCACGCCTGTAATCCC
AGCACTTTGGGAGGC


invisible?    
Gene introns: 0  

>20627 187 604     3q11.1    chr3:93849245-93849431 BLAT!
ATAATGTCTGCATTTTTCCATTGATTGGAGTGCATCCTTAGAAAACTGAAAATAACAAAA
ACCCAGGACATTTTTGGAAATTGTATGCTCTCTAGCAACTTTGCGTGAATTTTTATACAA
ACACTTATGAGTTATATAAAATGTTCTAAAACTAGAAAAAACATGGTCTTGTAACATGTT
ATTTTCT


invisible?    
Gene introns: 0  

>22840 214 604     1q31.3    chr1:195404475-195404688 BLAT!
TCACTTGATGCAAACACTACTATGCCTGAAATTTTAATTCTACTTGTAATAATTCCATGT
TATTCTCATGGTAATAATTTTCTTAAAACATATGTCCCCAGGTCACTGATGCAGTTTTAT
TTGTTTTGTATATTAATCTCTTTCATTTACTCCTTCCATGAGTCAGTCTCACAAGATTTA
AGACTTAAGACATTAAATCCCTAAGTAGACTTAA


invisible?    
Gene introns: 0  

>21155 177 601     3p14.1    chr3:68034919-68035095 BLAT!
ACTGAACTGGCACTGAGGGATCAGGAAAGAACTGGTATCAGAAGTATCATTGGTCAAAGC
AAGACAGAGTAAAAGGCTCTCCCATTGCAGTTTCTTGTCCCTGGGTAATGAAGTCTCTGT
TCATACACTTGTTCATTTATTCAACAAATATGTGTATATCTAAATGTTGAACTCTGT


invisible?    
Gene introns: 0  

>3004 166 599     9p21.3    chr9:25130884-25130719 BLAT!
TTTAAGGTCCCGTATCCTCCACATTTAATATCACAATGCTTGTAACCTAGAGTAAATTTT
CTTAAAATGATGGAGAAATAACTGTAAGTGTAGTAAAGTGAGGAATTAATAAGATAAAGT
AAAATGGTGAAAAAGAAGGGGGAAATGCAGTGATGTAATTGAAACA


invisible?    
Gene introns: 0  

>10930 208 599     8p23.2    chr8:5602184-5601977 BLAT!
GCTAGTTAATACAACACATTTCAAAAAACACAAAGTTACATATATATGGTATATTTTATG
CATTTGCTTGAAAAGAGAATTATATAAGAATCCTTCTGATAGAATATTTGTTTTCTGAAC
AATTAATGATTCAGTATATTCATAACAAAAGGATATCAGGTAATATATGACTATAAATAT
TGTCTTTATTTCCACAATTTTAAGTCTA


invisible?    
Gene introns: 0  

Shown 721-750 from 1945 sequences on 25 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs