Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 751-780 from 1945 sequences on 26 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18525 155 599     8q21.13    chr8:81480530-81480378 BLAT!
ACCAAGGTTATTTGGCAGCTAATTCTAGATTTGGATCATTGCCCAAAGTTGCACTTGCTG
GTCTCTTGGGATTTGGCCTTGGAAAGGTATCATACATAGGAGTATGCCAGAGTAAATTCC
ATTTTTTTGAAGATCAGCTCCGTGGGGCTGGTTTT


invisible?    
Gene introns: 0  

>3588 183 598     3p11.2    chr3:87694062-87694244 BLAT!
TGTCTGAGCTCCACCTCCTGTCAGATCTCCTGCAGCATTAGATTCTCATAGGAATGGGAA
CCCTATTGTGATCTGCGCATGTGACGGATCTAGGTTGCACGCTCCTTATGAGAATCTAAT
AACTGATGATCTGTCACTGTCTCCCATCACCCCTAGATGGGAGCAACTAGTTGCAAGAAA
ACA


invisible?    
Gene introns: 0  

>11229 185 598     3q13.11    chr3:102849703-102849519 BLAT!
CAAGAAAAATAAACCCTTTGTTAGTTACTAAGAGTCAGATCCTAGTCTTAGCTAATATAC
TTGCCTAAAGGCATTTATAATTTTTAAACATGTTAGAACCAAGGTCACAAAATGACTAAT
AATAAAATAAAATATCTCAGGCTGAGTTTAAATTGAGTGGTTCTGGTATTAACTACTACA
GATTC


invisible?    
Gene introns: 0  

>3943 143 597     11q14.3    chr11:90848512-90848654 BLAT!
TTTGGTCCAGATATGAGCATTGAATTGTATCTTCTTGTTAAAACACTCAGCATAAAAGGC
TGAAATGGGTGGATGATGGGAAACCTGCTCAGCCACAAATGTTACACTGTTTTTGGAAAC
CCAGGGAACTGGTCCTTCTGAAA


invisible?    
Gene introns: 0  

>6801 142 597     1q32.2    chr1:208837030-208837171 BLAT!
CACTCCTCTAGCTTGGCTTCCGAATAAGAGCTCAGCCAGCTCATGTTACTCACAGTCTTC
ATAGAACATGAAAATGCAAGAAACACTGTTGGCATAAGCCCCTTCGAAATTGAGATTGTT
ACTGAAGTAAAAGTTCACTAGC


invisible?    
Gene introns: 0  

>18697 158 597     8q12.1    chr8:56541663-56541506 BLAT!
TTTTTATTATAAAAATATAATAAAATTTAAATGACCATATTATTTCTCTTCAATCACATT
AACCATATTTCTTTGGGGGGAAAAAACCTTATATCTGCAGGATAGCACAGGATAAATCTG
ATTTCTACCCTGAAGCTAGTATTAAAGACAAAACGGTT


invisible?    
Gene introns: 0  

>4059 218 595     3p14.1    chr3:67887324-67887107 BLAT!
GGGAACATGGTAAGACCAGTGAATTCCATGAGCATAAGCCCACTGCCGCACTTCGTTAGC
CATAAAGTGAGTGCTTTGGTCAGAGGCAATGCTGTATGGAATACCATGCTGGTGAATAAG
GCATTCTGTGAGTCCACAGATGGTAGTCTTGGCAGAAGCATTGTGTGCAGAATAGGCAAA
CCCATATCTGAGTAAGTGCCTATTCCAGTGAGGACAAA


invisible?    
Gene introns: 0  

>13019 152 594     8q12.1    chr8:56963512-56963361 BLAT!
ACAGCTTGACAAAAGTAAGCTGAAGCCAGGAACAAGAGTTGCTTTGGATATGACTACACT
AACTATCATGAGATATTTGCCGAGAGAGGTGGATCCACTGGTTTATAACATGTCTCATGA
GGACCCTGGGAATGTTTCTTATTCTGAGATTG


invisible?    
Gene introns: 0  

>13952 145 594     17q11.2    chr17:30077286-30077142 BLAT!
GACCTCAGGTGATCCACCCACCTCAGCCTCCCAAAGTGCCGGGATTACAGGCATGAGCCA
CCGCACCCAGCCATCCTTTTTTTCTTGCCAGGGAGTCACAGGTCTCTCTTGGAATGCATT
TCCAGTGTAGCGGCTGTTACTGAAA


invisible?    
Gene introns: 0  

>12158 212 593     2p14    chr2:64302373-64302584 BLAT!
GGGGGTGGTATGGAGAGATAATGGGCGATGTTTCTCAGGGCTGCTTCCAGCGGGATTAGG
GGCGGTATGGGAACCTAGAGTGGGAGAGATTAAGCTGAAGGAAGATTTTGTGGTAAAGGG
GTGATATTGTGGGGTTGTTAGAAGAAACATTTGTCGTGTAGAATTATTGGTGATGGCCTG
GATACGGTTTTGTATGAATTGAAAAACTAAAT


invisible?    
Gene introns: 0  

>12305 193 593     5q14.3    chr5:84840302-84840110 BLAT!
AATTTAGTCACTCATCTTTACTATATAATACAGTTTATCTTATTTAATCTCTTTTTCCTA
AAATAGGTTATTGTAATTCAGTTTGACTAAGGAATTAATATAAAATATTAACCTTTAGCA
AGATGTCAATTTCTGTTCTTTCAACCACCACTTAAAACAGCATAGTGATTACATGTCATT
TTGTTTTACAGGC


invisible?    
Gene introns: 0  

>19884 214 593     1q25.2    chr1:176269188-176269401 BLAT!
TCTGGGCATGGTGGAATTCAAGGCTTATTTTTATTTCCCCCTTCAGTTTGATGATTCCCT
CCTTGGAGATCTTCACCTGCAGTTCCTGGAATGAGTGATGCTGCTTCCACATGGTCAATT
TCACCCCTTCATATCTCTTCTGCATCTATGACACACCTTTATCTTCTTGTTGCTGAGGCT
GCCTCACCCTTAGCAGAAGCTTTTGGTGGCACTT


invisible?    
Gene introns: 0  

>12815 137 591     11q12.1    chr11:57663885-57664021 BLAT!
TTCTTGTGGTTTGCTGGCAGTTTTGGGTGTTTCTTGGCTTATAGAAGCATCACCTGGATC
TCTGCCTTCATCTTAACATGATCTTGTCCCTGTATGCATGTTTATGTCTGTCTTTGTGTT
CAAACTTCCCCTTTTTA


invisible?    
Gene introns: 0  

>15132 139 591     11q14.3    chr11:90835670-90835808 BLAT!
AAAGACAATTTTTAGAAATTAAGATGTAGCAAACACAAGAACACAGTCACAAAACAGTAT
ATTAAATAAATTATGTCTAAAAGCTTCACATCATAAAAGACAGGATAGATTGAAATTGCA
TCCAATTAAAAGATCAATA


invisible?    
Gene introns: 0  

>17772 167 591     14q21.1    chr14:38102398-38102564 BLAT!
GCTTGATGTCTGCCCAAATGGCCACCCGGTTTTGTGCGTGAAACCCAGGGCCCTGGTGGT
GAAGGCACCCGAGGGAATCTCCTGGTCTGCATGTTGCGAAGACCGTGGGAAAAACATAGT
ATCTGGGCTGTAATGCAATGTTCTTCATGGCACAGTCCCTCACGGCT


invisible?    
Gene introns: 0  

>6047 149 590     6p22.3    chr6:22552885-22553033 BLAT!
ACTCAAACATCTCCTCCTCAGAGAGGGCTTCTCTGCTGCACTATATACAAGAACACACAC
TACGCCATATCATGCTCAATTCTTTGGCCCTACTTTATTTTTCTTTGAGGCCTTTTCACT
GTATGTTATCATATTATACCATAACATAT


invisible?    
Gene introns: 0  

>12354 199 590     15q21.2    chr15:49826668-49826470 BLAT!
TTTATTTAGGCACTCTGATGTTGGGTGCATATATACTTTTAATTGTTACATCCTCTTGAT
AAATTGATCCATTTATCATTAAAAAATAATGTTATTTGTCCCTTGTGACAGTTTTTGGCT
TAAAGTCTACTTTGTTTTGCTATCATATGAGTGTTCTTGCCAAATTCATGTGGAACCTTA
TTTCTCAGCATGGTAATAT


invisible?    
Gene introns: C15orf33 (49620591 - 49913118)  

>10613 168 589     1q23.3    chr1:161396592-161396759 BLAT!
TCTGTGACATTTGGTGTATTCATCAACAGTGGGAATGGAAATGAGACAGTTGAGCAGATT
ATTATGAATCTGAGTGCTTTGAACCTACAAATCTCCCTGAGCCTCCCTTACTAGCAAAAG
AGCCCCCTTTCTTCCTATATGAACAAGTTGAAATTCTCTTGTTTGAGG


invisible?    
Gene introns: 0  

>12016 179 589     6p22.3    chr6:21600138-21599960 BLAT!
AGAAGAGTTCTTCCTTTTACAAAGATCTTTGAAGAAACTTAGATGCCATGTTGTTCTAAG
GTCATTTTAAAAAATGGAATTCCAATTGCAGAACGCAAATGCAATTAAAACTAAATATAT
GAGCACCACACATGAAAAAAATGTTGAAAACTAGTAGCTATCTTTAAGAGATAAATTAT


invisible?    
Gene introns: 0  

>13686 222 589     1p31.1    chr1:73090367-73090588 BLAT!
AAGTGTATGCAACTGCTTTTGTCTCAACAAGAGGTAAACTGGCTGAACATTTTAGATTAA
CTTTGGAGGATAGTCACTGTTATTTGAAAGAAATTCTATATTGCTATAAAATTGTATTGG
AAACTGCTTTAGCTTAGCTGCAAAACCCGGGCTAAAACTCAGGGCTGAAAATATTACTGT
GCTGATTCATCACCTGAGCAGAGCAGAAATCATAAACATTTA


invisible?    
Gene introns: 0  

>20607 187 589     2p24.2    chr2:18974024-18974210 BLAT!
AGAAGCTGGCATTTGTGAGAGCTTTAATCAGCCTCTGAAATATACCCGACTTTGCTCTGT
GACCAGCCTTCAGACAAGATGAAGCCTCATGAAACCTGAGCTGGGCTTGCTTATCTGAGT
CTTCCTACTGGAAAGGCTCCTGCAGCAAAGTGTGCCCAGACCCTAGAAAGGGAGCTGCTC
TGCCCCA


invisible?    
Gene introns: 0  

>21533 236 589     11q14.3    chr11:88625621-88625386 BLAT!
TTCAAGCCAAGTTCAGCAATGGGTTTTTATCCCCAAATACTTTACACTTAAGGTCCCAAG
ATAAACTTGGAGGTCCTGGACAAGTTAAAAAGTGACATTCTTTACTGACTACAGACTAAG
AAACCTGTCCAGGGACTGTGTAGACAAGGTATGAGGCCAGTCTTCCCCAAGGTGCTTTTA
TCAGCTCTGCAAGCTGAGATTGACTCTTTAAAGGGGGAAGCATACACTTCCTGTCA


invisible?    
Gene introns: GRM5 (88237743 - 88796816)  

>15870 189 587     5q34    chr5:166524117-166523929 BLAT!
CTCTCTCAGGCGGGGAAAGAAAAGACGATAGTTAGCATTTAGATGGATGACAACGCAGCA
GACAGTGAAGTCTGAACCCGGCAGAAAGGCATCCAGCATTCTCTGGAGTGTGTAAGGCTT
CATGACTGGCTGACTAGATCACGGACAAACATGACTCACAGTGCAAGATAAAGAGAAAAA
CCAAACAAT


invisible?    
Gene introns: 0  

>239 147 586     1q23.3    chr1:163803836-163803981 BLAT!
GGAAACTAATAGGCTTTTACAGACATTTACACAAGCTAGAAAAATAGTTGAATTCTTTCA
TCAACCATGCTATTATCTATATATACCTGACAGTGCCCCAAATTCTGCATTCTTAGAGGT
AAAATTAGGCCTTTGTCTAGTGAACTC


invisible?    
Gene introns: 0  

>6625 213 586     3q26.33    chr3:179054688-179054581 BLAT!
AGACCAGCCTGGTCAACATGGTGAAACCCCGTCTCTATTAAAAACACAAAAATTAGCCGG
GTGTGGTGACACACGCCTACAATCCCAGCTACTTGGGAGGCTAAGGCATTACTTAAGGTG
TTTTTCCAAAAATCCAATTCCTGGAGCTAGATGTATAAAAAGCATAAAAACAAAATTATC
AACAACTAGGTTAATTGTTAGGTGAAGTAGTCA


invisible?    
Gene introns: 0  

>2975 220 584     2p25.3    chr2:2337837-2338056 BLAT!
TTGATAAGCATAGTATCTAATGTTTTACCCTTAAGGTAAGGCATCCCTGGACCCAGCAGC
ATTAAAGAACACGTCTTCCCTTACCACACTGTCACTGCATTTCATTCAACCTCATCGTGT
TGACAACAACTGCCCCAGCCTGAATCGGGCTCCAGTGAAGCATTTGTATTCTTTCCACCC
ATTCTCTGCATGACTTTTAGAGCTGAGATACCAGCCCTCA


invisible?    
Gene introns: 0  

>6038 171 584     20q11.23    chr20:37243912-37243737 BLAT!
AAAAGTTGGAGAAGATGAGGGATCATGAACGAAAGGAAGAAACTTTTACCCCAATGCCCA
GCCCTTACTACATGGAACTTACGAAGCTCCTGTTAAATCATGCTTCAGACAACATCCCGA
AGGCAGACGAAATCCGGACCCTGGTCAAGGATATGTGGGACACTCGTATAG


invisible?    
Gene introns: ARHGAP40 (37230576 - 37279295)  

>4534 145 583     3p26.1    chr3:5691816-5691672 BLAT!
CGTTAAACAGCTTTATTGATGTATAATTCACATACCATACAATTTACTTATTTGAAGTAT
ACACCATCAGGCCAGGCGCAGTGGCCCATTCCCATAATCCCAACACTGTGGGAGACCGAG
GCAGGTTCAAGACCAGCCTGATCAA


invisible?    
Gene introns: 0  

>13500 162 583     3p13    chr3:70158604-70158765 BLAT!
GCTTAAAGCTGCACTCTTAATCCCACCAGCCAACTTAAAAATGGTGTAGAGAGAACATGC
AGGGGAAGAGCTTGGCCTCTGAGGTTCTGCAGTTTCATCCTATTTTCTTTCCCTGAAAGC
CAGACTCTACCTCGTATGAGTATGTGTGTCCTTTCGGATACT


invisible?    
Gene introns: 0  

>21182 171 583     1q23.1    chr1:157029502-157029671 BLAT!
CGTTAACAAAGGAGGAATGGCCACGAAATTCCTTCAGGGTTTTCCCAGATTTTAAACCAT
GAATTCTAATTGTCTGGTCAAAAGAAGCACTAAGGATCTGACTGCTATCCTTAGAAAAGC
TTAGACAGGTGACACCCTTACTGTGTGCCCTCTCAAATCTCCTTAAACATT


invisible?    
Gene introns: 0  

Shown 751-780 from 1945 sequences on 26 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs