Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 811-840 from 1945 sequences on 28 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18413 150 560     13q33.2    chr13:106825538-106825687 BLAT!
AAGCCTTAACTTTTATATAGATCTCCCACCTGCTTGCAGAGAGGGAGGTAAGCAGACTGA
TTCAAGCTGCCTTTGCAAAGTGCAATTGTATACAGACAGTTATGGATCTGAGCGTGGGAA
TGAGTTCATGCTATCCTTTGGAAGATTCTT


invisible?    
Gene introns: 0  

>20620 194 560     12q14.1    chr12:59689385-59689569 BLAT!
CAGCAACCAGCAGCAGCAACCAGCTGGGTTCCCCTTCCACCCCCTTGGAAGCTTTGTTCT
TTCACTCTTTGCAATAAACCTTTTTGCTGCTCACTGTTCGGGTCCACACTGCCTTTATGA
GCTATAAGACTCACTGCGAAGGTCTGCAGCTTCACTCCTGAGGCCAGCCAGACCACGAAC
CCACCTGCAGGAAT


invisible?    
Gene introns: 0  

>24656 197 560 143285+,204111+,164877-,188469-,49324-     7q32.1    chr7:128303042-128302917 BLAT!
CTTCCTGGATACAATGGGGGTATAGGCATTGGGTAAATATAGCCATTCCAAATGGGAGAA
ACTGGCCAAAACAAAGGGGCTACAGGCCCCATGCAAGTCCAAAATCCAGCAGGGCAGTCA
AATCTTAnGGTAGGTTCCCATGGTCTTGAGCAGCTCTGCCCCTGTGGCTTTGTAGAGTAC
CTGCCCGGGCGCCGCTC


invisible?    
Gene introns: 0  

>9027 140 559     16q22.1    chr16:69790886-69791025 BLAT!
AGTTCTTCTTGGCGCCTCATCAAATCCTGTCTCATTAGCATGACCTGGTGCTCATGGCGT
GCAGCTTCCATCTCCATCTCCAGCTTCTCACGAGCCTCCTTGATGTTGCGGTCCACTTGG
TCCTGCTGCTGCTTCTCCAT


invisible?    
Gene introns: 0  

>9333 184 559     10q26.3    chr10:132827865-132827681 BLAT!
CGTGTAGCAGGCGTGAAAGTAACATTCATCTCCTTGGGCATCTCAGAGCTCTTGTGGGAT
CAGGCTGTGTTGTCAATGAGCAGTAGTATTTTGAAAAGAAACATTTTTTTATCTGAGAGT
GAGTCTTAAACGTGGGTTTAAAATATTCATTACACTGTGTTGTAAACAGATGTGCTGTCA
TCCA


invisible?    
Gene introns: 0  

>13236 186 559     13q12.11    chr13:22346558-22346373 BLAT!
AAATGGTGATGATTCAATGAGGTGTTTGCAGATTGCTTTACACTTAGTGTTATATAAATG
TTTGCTTATAAAGTTAATAAAAATGAATAAGCCATGCTACTATCTAACGAAATTTTTCTA
ACTAGGCAAATTAAATTCCTCTAACTTCATTTCATTTCTCCTGTTCATTATTCAATGGAC
CTATTT


invisible?    
Gene introns: 0  

>14835 157 558     8q21.3    chr8:90497597-90497441 BLAT!
TGGGATTACAGGCGTGAACCACTGTGCCCGGCCAACTGTAACTCATTCTTATACTTTCAG
GTCAAATCTTACTTCTTCATGTGAAGAAATTTTTCCTGTTAAGTGAAAATATCTTTCTAC
TTTAATGGCTTTATCTTACACTTAGCATAAGGTGCAA


invisible?    
Gene introns: 0  

>17815 157 557     20p12.3    chr20:8875683-8875527 BLAT!
TTTTAGTGCCCATCTGCTAAGAGAAACTCACTTATTTTCAGTTGTAGCTAAATTCCAAGA
GGCTTACACAGCGCTAAGATGTGCCAGAAGGAGAACCCACTGATCCTCAATGTCGTCTTT
CTATGCAGGCCTCTGCTGAGACATCCACCACTCTACG


invisible?    
Gene introns: 0  

>11924 119 556     14q32.31    chr14:102988023-102987905 BLAT!
ACCTGAGGTCAGGGGTTCGAGATCAGCCTGGCCAACATGGTGAAATCCCGTCTTTACTAA
AAATAGAAAAATTAGCTGGATGCAGTGGTGAACGCCTGTAATCCCAGCTACTCAGGAGG


invisible?    
Gene introns: 0  

>13785 120 554     18q12.2    chr18:36533465-36533584 BLAT!
AGGCAGGAGAATGGCGTGAACCCAGGAGGCGGAGGTTGCCGTGAGCCGAGATCGTGCCAC
TGAACTCCAGCCTGGGTGACAGAGCGAGACTCCATCTTAAAAAAAAAAAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>18659 170 554     Xp22.13    chrX:17442472-17442641 BLAT!
TCCTCATGAAAGACTAGACTTTAAGGAGAGATTCTGTGCAGGTCCCTACAGTGTGGAGAT
GGATTGATTGGGCCTACAGATTGCAGCTAATCAATTCATCCTTTGCTTCCCAAAGGTTTA
TGCATTTGGGTGGAGTTCACAATGAGTGGTCTGGGTGCAGGGCCGTGTGG


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>10110 137 553     2q24.1    chr2:156623921-156624051 BLAT!
TTCCAATGAGATGAACCGGGTGCCTCAGTTGGAAATGCAGAAATCACCCACCTTGTGCGT
CAATCTCACTGGGAGCTACAGACTGGAGCTGTTCCCATTCAGCCACCTTGCCAGCCAACT
CAAGTTTTGCTTATTTT


invisible?    
Gene introns: 0  

>10893 214 552     13q31.1    chr13:79623981-79623768 BLAT!
TGGACCCAAGAGAAGAACTAGATAATACTTTCTGAAATAGCTTACAGGTGCATACTATCA
AGAGTTCAGGCTGAGTCTGCAAAGTGAAGGGAAAGATGGGTCTGCTTCTAGTGCTGGCAA
TGACTATCAAATGCTACCAGCAGCCGTAACAAGAGCAATAATTTCCCAGGTCTTCTTGAC
TTTAGCCAAGTTTTAGTAAATCTATTTTTACTCC


invisible?    
Gene introns: 0  

>7460 170 550     10q26.2    chr10:129268752-129268921 BLAT!
AAAATATGTCTGTGTTGAGCCCTGCCCTGCCTTGACAGATAAAGTGAGTCTTATCAAGGG
ATATACATTACACAACGTCTTTTGTTTCAGATCTAACACGAATCCATGTGTCCAGGGAAA
CTCTCTGAAATTCATGGTTCAGAGCCTTTTGTCTCACAAACTAAGTCATG


invisible?    
Gene introns: 0  

>15827 104 548     19q13.43    chr19:57406606-57406709 BLAT!
AGACAGGGTCTTGCCCAGCCTGGTCTTGAACTCCTGGCCTCGAACTTCTGGCCTCAAGCA
ATCCTCCCATCTCAGCCTCCCAAAGTGCTGGGATTACAGGCGTG


invisible?    
Gene introns: 0  

>23992 197 548 73814+,203449-,73224-     9p12    chr9:43313746-43313842 BLAT!
TTTCTTCCTGAGTAATCTTTCTTTCTTTTTAAATCGCTCCTCCCCCCGCGTACCAGATAC
TTGCATGTAGAAGGAGGTAATTTTCATGCCAGTTCACAGCAnTTGTGTGCTCAGTTACTG
GCATGGCACTCCCAAGATTGATAATTAGGAAAGTTGATAAGCAGACCGCATTATTGGATG
CAGATGATCCTGTGTCA


invisible?    
Gene introns: 0  

>64 129 547     6q22.33    chr6:129894577-129894705 BLAT!
GACAACTACAAACCACTGCTCACAGAAATAAGAGAGGACACAAACAAATGGAAAAACATC
CCATGCTCACGGATAGGAAGAATCAATATCGTGAAAATGGCCATACTGCCCAAAGTAATT
TATAGATTC


invisible?    
Gene introns: 0  

>1409 120 547     1q25.3    chr1:181247530-181247649 BLAT!
CCCACTGTCAACATTAGACAGATCAACGAGACAGAAAGTTAACAAGGATATCCAGGAATT
GAACTCAGCTCTGCACCAAGTGGACCTAATAGACATCTACAGAACTCTCCACCCCAAATC


invisible?    
Gene introns: 0  

>8377 127 545     2p24.3    chr2:13670940-13670814 BLAT!
ACTAAATATAAAATAGTGTTTAGCTTTCTTTGGTCTAAATACTAATAAAAATAGGTGCTA
AAGGAAATTTATCAGTAAAAAGGCACTAAGGCCTATAAAGTCCACTGCCAAAGTCCCTAC
ATTTAAA


invisible?    
Gene introns: 0  

>21386 164 545     12p13.2    chr12:10888910-10889073 BLAT!
TAGGTGTAAATTTTCTTTATAGAGATATGTGAATTGATTATGAAAATGGGGTAGAACAAC
ACTGAAATATAATATTAAATTATATCTTTTTGTCAGCCTGGTTGAGTGACAGGTTGGATT
TGATTTAATTTCATTTAAAGAAAATAAAATAATTTGACAATTCA


invisible?    
Gene introns: 0  

>14093 172 543     2p24.2    chr2:17109018-17108847 BLAT!
GGGCTAGTTTATTTCAACCTCGATAGTTAATAAAATGTAATCTTTCTGGGGTTTATAATG
AATGTCCCTGGTATTCAGCTTGACTTTCTATTCTGGTAGACTGAAAGTTGAACAACTCTT
AGTTCAGTGTTAGCCCCAGTTCTGTTTACCTTAGTAACCAGTAAGTTATCAG


invisible?    
Gene introns: 0  

>8114 236 542     2p12    chr2:76100156-76100385 BLAT!
CCTAGGCTATAACCCAGGGAGTCTTATCCCTGGTGTCCCTTCTGATTTAGGTATACAGCT
CTGGACATGGGCAGTTATGTAGGACCCATTCCCCACCATCCTTGCCAGGGCCCCAAGTTT
GTAATGGCTAAGAGAGGGACAGTGAGAGACAGAGAGAGAGAGAGAGAGATGAAGAGAGAT
AGAGAGACGGAGAGAGAGGGGGATGGAGAAAGAGATAGAGCGAGTCAAAGAGAAAA


invisible?    
Gene introns: 0  

>17581 167 542     6p12.3    chr6:51661890-51661724 BLAT!
GCTGTCATCCCAGCACTTTGGGAGGCTGAGGTGGGTGGATTGCCTGAGTTCAGGAGTTCA
AAACCATCCTGGGCAACACGGTGAAACCCTGTCTTTACTAAAAATACAAATATTAGCCAG
GTATGGTGGAAGACACCTGTAATCCCAGCTACTCAGGAGCCTGAGGC


invisible?    
Gene introns: PKHD1 (51480144 - 51952423)  

>16199 161 540     3q13.13    chr3:109232864-109233024 BLAT!
AGGACCCTCCGAGCCACGTGCGGGATATAATCTCCTGGTGCACCATTTCCTAAGCCCGTC
GGAAAAGCGCAGTATTCGGGTCGGAATGGCCCGATTTTCCAGGTGCCATCTGTCACCCTT
TTCCTTGGCCTGGAAAGGGAACTCCCTGATCCCTTGCACTT


invisible?    
Gene introns: 0  

>20354 187 539     14q22.1    chr14:51682021-51682207 BLAT!
GTTCTCCTTGAAGAGGTCCTTCACATCCCTTGTAAGTTGGATTCCTAGGTATTTTATTCT
CTTTGAAGCAATTGTGAATGGGAGTTCACTCATGATTTGGCTCTCTGTTTGTCTGTTATT
GGTGTATAAGAATGCTTGTGATTTTTGCACATTGATTTTGTATCCTGAGACTTTGCTGAA
GTTGCTT


invisible?    
Gene introns: 0  

>15243 185 536     4q32.2    chr4:163812140-163811956 BLAT!
ATTTGAGAAAACAGCAGACTCAAGAAGGCCATTCTCACCTTCTCCTGACCCTTTTCCCCT
GAAGCTGGTATTAATACCTAGGAAGGTCACTCTGTGATCACTCCCACCTTTCTCCTCTGA
AGCGGGTCATAAGACCCTTACTTGAGAACAGCCCTCCCTATACCTAGAGCAAAGGAACAA
CTTTA


invisible?    
Gene introns: 0  

>19896 160 536     2p11.2    chr2:85702704-85702545 BLAT!
ATCTACCTCCAGAACTTTTTCATCTTTACCAACTGAAACTCTACCCATTAAAAAATAGCT
GCCCGTTTCCCCTTCCCCATCTGTTGACAACGACCATTCTACTCTCTGTCCCTATGAATG
TGTCTACTCTAGCTGTCTCATATAAATAGAATCATATAGC


invisible?    
Gene introns: 0  

>12455 183 535     11q12.1    chr11:57726928-57726746 BLAT!
TCCTGCCCAGGATATGAATCAGTCCTTCATACAGCATATCCACAGGTGTATATGCCACCT
GCTCATTGGTCAATTAAATAGCTGTCTTGGTTATCAGATTGACTATCACAGTATCCCAGT
GCTTGAGTTAAAACAACCCTTATTTTGCTTAATAATGCCCCCAAAGCACAAGAGTAGTAA
TGT


invisible?    
Gene introns: 0  

>17228 193 534     19q13.11    chr19:34727539-34727347 BLAT!
CTGTATCCAGACTGTTGTAAACAATGTGGTTTGCTTGTGCTTTACTTCTGGGAGCCTGGA
ATTTTGGCACGTGCCACGCAGAGGGTGTCTGCATAATCAGCCCCCAGTAAAAACCCTGGG
CAACTAAGTCTGAAGCTTCCCTGGCAGACAATATCCCACGCATGTTGTTGCAACTCCCTG
CTGGAGAAGCTAA


invisible?    
Gene introns: 0  

>12892 172 533     3q11.2    chr3:95745766-95745595 BLAT!
AACCAGTGAAAGCTTCACCATTCAGATTCAGATATCTATGCCTAAATGAAGAATTGCCAT
AAATATACAGTTAGAGGCCAGACGCGGTGGTTCATGTCTGTAATCTCAGCACTTTGGGAG
ACCAAGGGAGGTGGATCACTTGAGACCAGGAGGTCGTTGCCTGGCCAACATG


invisible?    
Gene introns: 0  

Shown 811-840 from 1945 sequences on 28 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs