Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 841-870 from 1945 sequences on 29 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>14222 184 533     1p13.2    chr1:114862501-114862684 BLAT!
CTCTGTGGAATTTGTATTCACGTAGGAAGAAATTTGTATCCCTACACCAATGTCTAGCTA
GTTTTTAAATTTTTATTTAGCAGACATTTATATATACTGTCTGCACCAAGCATTTTACAC
TTATGAACTCCATTAATCCTTAGAATACTCAGATAAGATTTTCTTGATAATTTCTTCTTT
TCCT


invisible?    
Gene introns: 0  

>21153 169 533     2q32.3    chr2:195078348-195078180 BLAT!
GACACTCTTCTCCTCCGTCATTCCACAGCTCCTTTTTATGTTACTTCATCTTCTTGTGGT
TTTGTTTGTTTTTGTTTTTGATAATCTTATCTTTTCAGTGATGCTGTGCCTTACTGACAT
TTGCCATGTAGTAAAGGTAATTGGTCAAACAGCACCTCAGAATCAACCT


invisible?    
Gene introns: 0  

>7430 148 532     4q22.3    chr4:97199788-97199935 BLAT!
ACCATGGTGGCTTCCTCCCATGCCATGTTTTTGCCCTCGCGTGCTTTTCTAGCCAAATCT
GCAGTCTTTTTGCACTCTCAAGTCTTCAATTCTCCTCCCTATGTGCCTTAGCACATGCTT
TTCCCTTTTCCCCAGATGTCTCATCTTC


invisible?    
Gene introns: 0  

>19989 160 532     11q14.2    chr11:87251427-87251586 BLAT!
CACTCAGGAGAGAACAAGGGGCCCAAGTTACCATATGAGAGATCTAGATCAATATTTGTC
ACTAGTATCTAAGGGATGCTAATAGCTCTTTTATGAAAAAGGCCACTTCTATGAAGAGTC
AAGTAATTGTTAACCTTCCTGGCATAGAAATGGCTTCCAG


invisible?    
Gene introns: 0  

>10223 165 531     5q12.1    chr5:60638016-60638180 BLAT!
TTTGTATGACTTGGGGCAGTTCTTCACTGAACCAGCTGGATGTGATTTATGGTGAGACTC
TTTAACACTTCTACAACATTTACTAATAGTAAGAGTAATAACAACTAACATTTCATAGCA
CTTAACCAGGTGCCAAATACTGCCCTGGAATATAATCAGAAGAAG


invisible?    
Gene introns: ZSWIM6 (60628099 - 60841999)  

>12139 176 531     13q21.2    chr13:60101433-60101608 BLAT!
ATTAAAAGGTATTGGAATGAGTCTTAAGTTACCTTCTGATAACCTCTAAATTTCTCTCTT
GTCTAAATCTAGGGCAATGTGTTCTTGCAGTCCTATAAGAAATAACTCTGACTCAAAGGC
CATATTTGGCTAGCAGAGAAGGTTGTTGTAGAGAGCTTCTGTCCTAGGATTGGAGC


invisible?    
Gene introns: 0  

>13965 152 531     14q21.2    chr14:43555172-43555323 BLAT!
AGACAGGACATGTCCCCTTTCAGAGCTTACAATGCAGAGAAAACAGATGACTAAGCAATT
ATAACCATAGGGAAATAACATGTCCCTTAGGTGGGCAAGAAACATAATATTAGAGAATCA
TTTAGCAAAAGGTATACTAAGAAATAAATGTA


invisible?    
Gene introns: 0  

>14007 199 531     22q12.3    chr22:34773034-34773232 BLAT!
AAACAGAGCCAGCTAGCTCTCTGTCCTTTTCTTCTATGGACACTAATCCCATCCATGAGA
ACTCTGCTCTCATGACCTACCTACCTTCCAAAAGCACCACCTCTTATTATCACATTGGGG
ATTAGATTTCAACATAGGAATTTTGGGAGGGCATAAACATTCAGTCCATAACACTAGGTT
TTAGTATTTTCATCTGTGG


invisible?    
Gene introns: 0  

>14927 158 531     5q13.2    chr5:70868326-70868169 BLAT!
CTTATATCCGCTGCCAGCAGACTCATCCCGGGGTCCCCATTCGCCTTGTCAATTTCAGTT
CCTCTGCTCTAGCAGACATTCTTCATTCACATCCTCGAAGCCCCTGTGTTTGGACGCCAC
TTGTAAAGCACCAGATTCTGTTGCTGTTCGAGGCACCA


invisible?    
Gene introns: 0  

>21777 162 531     6q16.1    chr6:96006087-96005928 BLAT!
TATTTTTTTATAAAACAAAGGAATTAATGTAAACAGTTTGGAAAGAAAAGTTAAATAACT
TTAAAAAGTTATGTTGTTGCAAACATGTCAATTATACAGCTAAAAATTGGGGGGTGTAAG
TATAAGTATACTAGTTTCCTAATCTTAAAAATCAGCAATTAC


invisible?    
Gene introns: 0  

>5065 206 530     Xq21.32    chrX:92585854-92586059 BLAT!
CACAGTTGTTCTCAAATTATTAAGTTATTATCAAATCATGTTGACTTTATTTTATAAGCA
TTTTGCAAATAGCTCTCTACTTTTCTCACTTTTGTTATTTATTAGTTCAAATACTCATTA
ATTTTTGCCTATACTACTGGAAGTAGCCTCCTAAATGGTCTCCTTGACTCAACTTTTCTC
CATCTCTAACCCATTCTACACATCAC


invisible?    
Gene introns: 0  

>11832 166 530     3q22.3    chr3:137667153-137667318 BLAT!
AAGCAGCCTCTGATGAGAGGCACCACTGTCAGAGAGCTCCAACCTCACAGACATCCACAC
CAGGTCAGATGAAGAGGAATTCCTGGGCTGGCTTCCCACAGAAATGGGGGAGTAGCACTA
TCCCCAGGCATCCCCCAGCGCTGTGCCATCTGTCAGAACCACAGAC


invisible?    
Gene introns: 0  

>15627 123 530     13q13.3    chr13:37760942-37761064 BLAT!
CCAGGCCACACAGAAGGATTGTAACAGTGTATGAGTGACAGTCTGGAGTCCTTGGCACAT
ATATTTCTACTTTACTTTGTCATGGGCGACCTTGCTATTGACCCCCATTTGTTACATTCT
TCT


invisible?    
Gene introns: 0  

>21103 114 527     19q13.43    chr19:57688392-57688296 BLAT!
GAGAAGATGTATCATTGTTTGGGAGTGGGGAAAGTAGGCTGAAGGTATCAGGTCCTCATA
CCACTTCAAGGTAACATCAATTTGTTCCATTAGACAAATCAAATCGAAGAACTT


invisible?    
Gene introns: 0  

>5225 145 526     7q21.3    chr7:94434665-94434809 BLAT!
TAAAGTCAATGGGCAGAAAAAAAAATTACCTTTCCTATGAAGGCATACAAGAGACTGCAA
AGTTACATGGAAGTGTTGTGTTATGGACTGAACATTTGTGTTTCCCCTAAATGTATAAGT
CAAAGCCCTAACTCCCAATATGATG


invisible?    
Gene introns: 0  

>14926 148 526     12p12.3    chr12:16815351-16815498 BLAT!
AATCTATATGTATCCTCTACACTGAAAACTACCTCAAGAGACAGTGATAAGTATTAGAAG
AATTTTTAATGATGAAATTACACACATTGCTTGTATGGTATTTGTGGCAAATGGACTAAA
AAAAGAACACATAGCAGAGTTCCAGAAT


invisible?    
Gene introns: 0  

>17730 168 526     2p14    chr2:66353275-66353442 BLAT!
TGCTAAGCCGGTTACTAACAGACCTAAACAGTGCCCAGGATGGAATTCACACATGGAAAC
CAACCTCAAAGCCAAAATGTCCCCAACTACAAGAGAGGTGTATGCATCTTTAACAAAAAT
GGGCCTCATAATTAGCATAGGACAATTTTTAAGCATGCTAAAACTCTC


invisible?    
Gene introns: 0  

>20079 160 526     15q14    chr15:36664694-36664535 BLAT!
GCAATGAATATTTTCCAAAATCCAAACAACGCATGCATATTGTCACTCACCTAAAGGACC
TTATCTATCTGGTATTGATTCTGCATGAGCTTGCAACTTTCCATTAACAACAGATGCAGA
GACACTAGAATAGGGACTAACATTTATTAAGATGCTATTC


invisible?    
Gene introns: 0  

>13496 169 525     2q35    chr2:218637630-218637798 BLAT!
CACCACCTGATATGGTTTGGGTTGTATTCCCACCCAAATCTCATGTCAAATTATAATCCC
CAATGTTGAAGGAGGAACCTCGTGGGAGTTGATTGGATCATGGGGGCAGATTTCCCCCTT
GCTATTCTCTTTGATAGTGAGTGAGTTCTTATGAGATCTGTTTTTTTAA


invisible?    
Gene introns: 0  

>8898 149 524     14q21.2    chr14:45228709-45228857 BLAT!
TCTCCAGTATAAGAATGTCTCCTTCTAAGATAAAGACTGAGCAGTTTTGTTTGCAGTTCA
TTATGAAAGACTGGAGTTTCCTAAGCTCAGAGTTCCTTAGCTGAGATGCACACTGTGATA
GTTAATTTTATATATCAACTTGACTGGGA


invisible?    
Gene introns: 0  

>22098 176 524     1p31.3    chr1:61349237-61349062 BLAT!
CAGACAAACCTAATACTTCAGGATTTTGACATGAATGTCATTGGAAGTATAAGTCAATTT
GAGGGAAAATTGTTACATTTGAAACATTTAGGATATAGTATGTTATATCCCCACACTGGA
GATATGTTTAATCAACTCTTCTTAGTAATGACTTATAGTTTATTCATTTAAGTTGC


invisible?    
Gene introns: 0  

>8778 152 521     19q13.2    chr19:39708725-39708574 BLAT!
CCTTCGCAGGGGATCTCCTCCCCCAGTTATATCTCTTAGGGAATAAGGGAGATTTTAGGG
CAGAGTTACTGTTTTCATTTCCTGTGCCTGCTGTAACCAATGGCAATGCACTTAGTGGCT
TACAACACCACAGGTGTGTTCTTTCAGCTGTG


invisible?    
Gene introns: 0  

>4003 214 520     18q12.1    chr18:28416472-28416314 BLAT!
GTAATCCCAGCTACTTGGGAGGCTGAGGCAAGAGAATCGCCCGAACCTGGGAGGCAAGGT
TGCAGTGAGCCAAGATCTCATCACTGCACTGCAGCCTGGGTGACAGAGCAAGATTCCCTC
TCAAAAAACAAACAAAAAAAAATGGAGAGAGAGAAAGCAACAGAACTAATTATCATATAT
ATGTATGTATCTGGAAAAGTAAAACTCATAGAAG


invisible?    
Gene introns: 0  

>19571 174 520     3p24.3    chr3:19175096-19175269 BLAT!
CCTAATAGGCTTTATTGAACTTTCCATCTGTTTTCTCTCACATCTGTAACTTAAAATGAA
AGCTTTTGTTAAAGAAACCCAGAATTGTTCTTTTCTAATTTTTCTTAGAGCTTAAAATAT
TCTCAAAGTGTTGTAACTTCTAAATTCCTTGATACTATTTAGTCATATCTGGAT


invisible?    
Gene introns: 0  

>13555 141 519     14q22.2    chr14:54385764-54385624 BLAT!
TGAAGGAAAGGTTTTTGTGATATTGGGTTAGGTAAATAGTTCTTAGATATGACATCAAAA
TCCATAGGAGAAAAAATTTGATAATGTGGACTTTATTCAAAATTTCTGATCTTTGTGCTT
ATTTCTCTGGTGTGCTGTGTG


invisible?    
Gene introns: 0  

>13004 195 518     12q24.13    chr12:113469332-113469138 BLAT!
ACTGTCTTCAGAACTCCAAGATGTGAATCCATCCGTAATGGTCAAATTTGAGGTCCATAG
GGAAGACCTGTCTTTCGAATACATAGCAAAATACCACAGTGGGTTAATTTGGTAGAGCCC
ATCCAGTGTCCCTGAATTTGTAGGAAGCCAAATTAGAAGAATAATTTGTGAATAATTTGT
GAATAATTAGAAGAA


invisible?    
Gene introns: 0  

>16959 175 518     10p14    chr10:9804420-9804247 BLAT!
AGTACAGCAGTTAGATGATATGGTTTTATTATCAGAATTTAGGGGTAGCTTGAAGAGATC
ACTGGCACTTCTATATAATTACTGTTAGAAATAATTATTTAAAAAGAAGTATTCCAAGGT
CAAAATAATTTTTTGGTGAGTGTCCTTCATCGTAGAGTTAACTCCACAGAACGAA


invisible?    
Gene introns: 0  

>16950 197 517     6p21.2    chr6:36642327-36642134 BLAT!
AAACACCAGGGGTGGTTCGTTTGCATTGGGGCTGCCTTTGTAGTGAATTTCCAAGAAGAC
TGGGGGCTCGTCAGATCCTTTGGCCACACTGAGGAATGATCCCATTGCCTGTTCCTCAAT
CCAAGACTTGGGTCTGATATGGACCTCGGTTTTACTACTAGCACTTTTGAGATTCTTCTC
AATAATTTCGGCAAATC


invisible?    
Gene introns: 0  

>3771 161 516     2q32.1    chr2:187445405-187445245 BLAT!
GTTACTGGGATTAGTATACAGGTCTCTTGAAAGGCATTTATCTTTCTATTATATTATCAC
TGTAAACAATATGAGTTAAAAAGATTTTATAAACATGTCTGAGAATCTTATACTTACTTA
CATATTATCTCCAATAGGAAATCTTTCTTGACTACCAAAAA


invisible?    
Gene introns: 0  

>17576 227 516     4p16.1    chr4:10962599-10962825 BLAT!
CATTTGAGTCCAGGGCTCCTTGCGGTATTTCCTGCGTAACTAATAGGGTCTCAGGGGGAT
GAGATCAGCTAATGAACACCCAAGCTGGTTTGTCTGTTTCTGTGAGGTGAGGTGGAACCC
CTTCAAAAAATGAGAGACACGTGACCACAATGAGATGGGTATGTCTTTGGGGGCCCTGAT
CAAGACACTTTATGAAATGGTGTTCTTCTTCCTTTTACAAAGGAGTA


invisible?    
Gene introns: 0  

Shown 841-870 from 1945 sequences on 29 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs