Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 871-900 from 1945 sequences on 30 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>21740 148 516     9q31.3    chr9:111404237-111404384 BLAT!
TGCAGTGACAAGAGGTGAAAATATTCCCAACTAGGGGCAACTCCCCACTTAGCCACTTAT
GAGCTGCATACTTGGAACAAGTTGTTTAGCCTTTTTGATCCTCACTTTGATCCCTCTAAA
ATGGGACTTGTTACTCCTCAAGATTTTT


invisible?    
Gene introns: 0  

>12365 186 515     18q12.2    chr18:35905024-35904839 BLAT!
CAAATCTGTATCCTGTGCTTCCTGATACAGTGCACTGAACAGGACACAATGTAACTTCTA
CTACACAGTGAATACCATGAATCTAATCCTGAGCAATCTTCAGGCAGACACTGACTGAGA
ATGTTTCCAGAATAAAACTAGACCAACACTCAAACATGTTGATCATATTAGTAAGGAAGA
GGTTCA


invisible?    
Gene introns: 0  

>10841 167 513     5p13.2    chr5:35423319-35423485 BLAT!
AAGAAATATGCTGTCAGCTTGGAATCTTTGGAAGAAAAAACCAAGCCATGAAAAATAATG
TCTAAGCTTAGGCTCTTCGCATTAAAACTAATACATAGCTGGTGCACTCCCAGGGGCTAA
GTGAGGCAGAGCAAAAACAACTGTGGAGAAAAATGTGCACAGCTCAG


invisible?    
Gene introns: 0  

>3472 168 512     4q22.1    chr4:92908225-92908058 BLAT!
AAGAGATACATTTCTGTTGTTTGTCAGCTACCCAGTTCATGGTATCTTATTGTAGCAATC
CAGATAGACTAAGACACCTAGATAGCTCATGGAGTTTTAAATAATTTCAGTAATTTGTCT
ATATATTTTCTTGGAACTTTCCTGTCTTCAAATAATCACTATGCTTCC


invisible?    
Gene introns: 0  

>3552 150 512     19q13.2    chr19:41643563-41643712 BLAT!
GGCCAGGCTGGTCTCAAACTCCTGACCTCAAGTGATCCATCCTTCTCGGCCTCCCAGAGT
GCTGGGATTACAGGCGTGAGCTACCCACCCAGCCTATTCCCTTGGGCTTTTAAAAAGCCA
TTTCGGCCAGGCTGGTCCTGAACTCCTGCC


invisible?    
Gene introns: 0  

>12418 148 510     6p12.1    chr6:54550336-54550483 BLAT!
AAGCTTAAATAGTTCAAATGTCATTTATTCTCTTATTCTTGAAGAAAATGGCCTACTCCT
CTGCATTTATTGGCCACTTAATCCTTTCCTGGACAAATCAATTAACAGGTAGTATTTTAA
ATCATTATAGTCTCATTTTAAATCATCA


invisible?    
Gene introns: 0  

>9692 134 508     20p12.3    chr20:6194720-6194853 BLAT!
GCACTCTTGGAAAGAACAGGCTACACACTTGATGTGACCACTGGACAGAGGAAGTATGGA
GGACCACCTCCAGATTCCGTTTATTCAGGTCAGCAGCCTTCTGTTGGCACTGAGATATTT
GTGGGAAAGATCCC


invisible?    
Gene introns: 0  

>11558 138 508     3q26.31    chr3:172315591-172315454 BLAT!
AAACTTTTTCAGCCTAACTCTTATTGCTTGTAGAATACTGTAAACATCTGACAACACAAG
TCAAATAGATGGCAAAGTGGAGTTGTGATTCTTGCAAAAGATGCAGAATTTCATGAAATT
GATGAAAATAATGTTGGA


invisible?    
Gene introns: 0  

>20554 193 508     10p11.21    chr10:36122424-36122616 BLAT!
TCTCTCTTCTTTCTCAGGTCTGATCACGCAATTTGATTAGGGGTAGGGGAGGGGAGGAGA
GCAAAAGGAAATAGGAGGTCAAGGAAGCAAACGAAGTTTCCTTTCCTCTTTGAATTTTGA
GATGACTGATCAAACTGCCACCTTCACCTGCCTCTGTTTCTCAGCTTCATCTTACTCTCC
AATTAATAATGGT


invisible?    
Gene introns: 0  

>9420 176 506     16q12.1    chr16:50944226-50944401 BLAT!
ATTTATAGGTTAATTGTCTCTTTCCACTAGAACAGGATTTCTCAACCTCAGCTCTATTGA
CATTTGGAGCCAGATTATTCTTTGTTTTGGGGGATTGTCCTGTTTGGCAGCTTCCTCCAA
CACATTCTCTACCTCCAGAAGCCAGCAGCACCCCCTCCATGGTTGTGACAATCAAA


invisible?    
Gene introns: 0  

>14888 141 506     6p22.1    chr6:28908857-28908717 BLAT!
GCGCCTTAGACCACTCGGCCATCCTGACACCTGGGACACTTACCATCGCAAATTAATATA
ATCTTCGATTGTAATGAATGCGTAACCAGCGTTAAGTCATTACTACGTTCGCGATTTAAT
GAAAGAAATGGAAAAGGAAAT


invisible?    
Gene introns: 0  

>16944 177 506     14q24.1    chr14:69207672-69207848 BLAT!
CAACTTCTGGGTCTCTGGCTCAGACAATCTTAGAAAGCCAGAGCTGGGGGGTAGGGGTGC
CTGTTCCAAGGTCATCTAGTCCAACCCTCGCATTCGAGAGATGTGGAAACTGTTGCAGGG
TCCATTTGTGCCCACTGAATATCCATGTGCTTCCCTGAATTTCCCAGCCTTCCTTGC


invisible?    
Gene introns: 0  

>25124 195 506 194760-,202753-,25199+     1p34.2    chr1:43369225-43369110 BLAT!
AGCGTGGTCGCGGCCGAGGTCGGCCGAGGTACATAGGAATTGCCTTCTGCACTGCAGCCT
TTACCAGAGGGAAATCTTGTnTTTTACCACCTTGCTGAGTCTCTGTTTTGCTTCATTTAG
TAGGTCTGTGATAAGGTCATCTCTTGCTCTGAGGACTTTGAGTCTCGCTTGATTCATCAA
ATTGGACATCTGAAT


invisible?    
Gene introns: 0  

>18607 186 505     6q22.33    chr6:129893947-129893762 BLAT!
GACTTGCATCCCAGGGATGAAGCCAACTTGATCGTGGTGGATAAGCTTTTTGATGTGCTG
CTGGATTCAGTTTGCCAGTATTTTATTGAGGACTTTCACATCGATGTTCATCAGGGTATT
GGCCTGAAATTTTATTTTGTTGTTGTGTCTCTGCCAGGTTTTGGTATTAGGATGATGCTA
GCCTCA


invisible?    
Gene introns: 0  

>21732 166 505     4q13.1    chr4:59549620-59549455 BLAT!
TTTTGTAAAGCATCAATAATTTCACTTTCCTTCCATTCAAGCTTCACTATAAGTTTGATG
TTTGTTCTTTCTTTAATTTTAGCAGAATTCATGTTACTCTGATGGGGCTTTTTTCAAACT
GATGTCTTATCTTTCTTATTACCTCAAATGGATATGAGGTTTAAAA


invisible?    
Gene introns: 0  

>11896 130 504     6q15    chr6:89275391-89275520 BLAT!
CATTCACGGAGCGCCTACTGTGCCAGGAATGCTCTAGGAGCTAGGGATACAATGAACAAA
GGAGACTTTGTTCATACAAATGCTAGGAGCTAGGATAGCAATGAACAAAGCAGACAAAAC
TCCCTGCCCA


invisible?    
Gene introns: 0  

>24324 172 504 106783+,202510-,10866-,159147-     Xq12    chrX:64788072-64787961 BLAT!
GAGAAGAACATAAATGACCTGATGGAGCTGAAAAACACACCACAAGAACTTCGTGAAGCA
TACACAAGTATCAATAGCCAAATCAATCAAGCAGAAGAAAGGATATCAGAGTnGGGACTA
TGTGACAAGACCAAACCTACATTTGATTGGTGTACCTCGGCCGCGCCACGCT


invisible?    
Gene introns: 0  

>9216 124 503     8q22.3    chr8:101804582-101804705 BLAT!
CCAGTCTTAATGTTGTGTAGAGTGAAAAATAAATGTTGAAAACCAGGCCATAGTGAGGTT
AAGAATATGGTTAAGTGGCCGGGTGTGGTGGCTCATACCTGTAATCCCAGCACTTTGGGA
GGCC


invisible?    
Gene introns: 0  

>19736 135 503     13q31.2    chr13:89706548-89706424 BLAT!
GCGTACGGGGGTATTATAACATTCTGAAGAGACAATGTCTACTTTGATATCCTTGGCCCA
TTATATTGACAGCATCATATAAATAAGAACATATGTGCAAAAAGTAAAATTACATTGAAG
GTTTTATTAGGACCC


invisible?    
Gene introns: 0  

>5848 174 500     10p14    chr10:9020964-9021137 BLAT!
CAGGAAAATAATATTTCATAGAAACGATGACTTATTCTTCCCTCCAATAGTGTTAATCAG
ATTTCATTTATTTTTATAGCATGCCAGGCATTAGCATTACCCTCTAGACACAGTCCCCTT
TCTATTTGTCCTTGGATAAGTTATCTGCTGTATTAGGATAACTTTCTTCCTCAA


invisible?    
Gene introns: 0  

>14239 195 500     Un_gl0002210    chrUn_gl000221:80714-80908 BLAT!
TTTACTTTAAAAATTTTAAAACACAACTAATGAATATGGTAATTCTCTTCCAATCCGTTA
TCTTTTCTCTCACTAAACTAATTTGTGAGCCTTCAATTTACACCGTTAGAAAATATGCTC
TAGTGCACATACTAGGATAAAATAACAGGGTCATAAGACAGGTGCACTCCATAATCTTTG
TGACAACTTACACTT


invisible?    
Gene introns: 0  

>22485 138 500     12p13.31    chr12:7759709-7759601 BLAT!
GCTGCTCGTCCTGTCTTGCATACCATTCTTCTAGCTCCTTTATTGCCTTTTCTTTCCACT
CTGCTTCTTGCTTCCGAGAATTGGCATCAAGGGCTTCCAAGCGTTCCATTTGTTCTTCTC
TCCATTTACGGATACTTT


invisible?    
Gene introns: 0  

>12112 206 499     4q32.1    chr4:156770030-156769825 BLAT!
CAAAACAAAGGATCAGCAAACATTTTAAGTAAAAAGTAAAAAAGATTATTTGAGTCCATG
CAGTTAATTCCTGTTCTGTTTAATACTCATGAACATTTTAGCTCTCCATGAGTCCTGAAA
GTTTTTCCTCTTTTCTGATGTTACAATCTCCAAAGTTATCAGAAACCTGCATTTAAGGGC
ACCTGTTAGAGTTTTGTAGCTGATTA


invisible?    
Gene introns: ACCN5 (156750880 - 156787425)  

>21330 227 499     Xq28    chrX:149283557-149283765 BLAT!
TTATGGAGAACATTTGTTTATGCTACATGGAAAATCTCTAACTGTGATTCCATACAAGTG
TGAAGTGTCATCATTAGCAGGTGCTCTTGGAAAACTCAAGCATAGTCAAGATCCAGGAAC
TCATGTCGTGTCCCATTTTGTAAACTGGGAGACACCTCAAGGATGTGGACTTGGGTTCCA
GAACTCAGAGCAGTCAAGAAGAATTTTAAGGAGACGAAAAATTGAAG


invisible?    
Gene introns: 0  

>10834 191 498     9q21.33    chr9:88078455-88078645 BLAT!
GTCATTTCTTCCCTTCTGTCAGACATAATTCCTCAGTTTGGCCTTCCCACCTCTATGCAG
TCTGATAACGGACCAGTCTTTACTAGCCAAATCACCCAAGCAGTTTCTCAGGCCTTTGGT
ATTCAGTGGAACCTTCATATCCCTTACCGTCCTCAATCTTCAGGAAAGCTAGAACGGACT
AATGGTCTTTT


invisible?    
Gene introns: 0  

>12377 165 498     Xq21.33    chrX:95229011-95228868 BLAT!
CGCCCGGGCAGGTACGCGGGGCATGGCCAAATGTGTGTGGAAACACCCACCTGGTGATGA
GATATATCGCAAAGGTTCAATCTCTGTGTTTGAAGTGGATGGCAAGAAAAACAAGATCTA
CTGCCAAAACCTGTGCCTGTTGGCCAAACTTTTTCTGGACCACAA


invisible?    
Gene introns: 0  

>14014 167 498     17q24.3    chr17:69310131-69310296 BLAT!
TGGCCAAGCCACAAATTCACTTTGTGCCCAGTTAAATCCTCATAAGATAGTGTCTTTGAC
AAATGATTGTTTTTTTTCCTTCCCAACCCAGAGAAATGCCAGACTGAGCTATTTTCACTT
TTGGTGGGAAATGTTCCATTTAGACTGACGCAAAATTACGTGGCAAA


invisible?    
Gene introns: 0  

>15046 192 498     3p21.32    chr3:44127159-44126968 BLAT!
TTCAGAAATCACATATTCTACAAAGGATTATTATCTAGAATATACAAAGAACTCAAAATA
ACAAATAATTCAATTAGAAAATGGGCAAAAGACATGAACAGACATTCCACTGCAAAGGAT
ATATAGGTAGCAAATAAGCACATGAAAAAATATTCAACAGAACTGTCCATTAGGGAAATG
CAAATTAAGACC


invisible?    
Gene introns: 0  

>19029 110 497     4p11    chr4:49104934-49104847 BLAT!
AAGGGAATGGAATCAACACGAGTGCAGGGGAATGGAATGCAATGGAATGCAATGGAATTG
AATCATCCGGAATGGAATGGAATGGAATGGAATAAACTCCATTGCAATGG


invisible?    
Gene introns: 0  

>22179 138 497     2q11.2    chr2:101125999-101125862 BLAT!
GACCTCCGTCTTATCCGGAGCTGCAGTAGGAAGTTGCTTGTTCTTCATTTTTGCTTTAGC
CATGTTGTAATCCCCAGAATCAAAATATTTTTGCCCTTTCTGCAACCGTTTCCTTAAGAA
ATCTGAACCTCCAGGCTT


invisible?    
Gene introns: 0  

Shown 871-900 from 1945 sequences on 30 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs