Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 931-960 from 1945 sequences on 32 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>16672 114 479     10q23.31    chr10:91693639-91693752 BLAT!
GCCCACTTGATCATGGTGGATAAGCTTTTTGATGTGCTGCTGGATTCGGTTTGCCAGTAT
TTTATTGAGGATTTTTGCATTGATGTTCATCAGGGATATTGGTCTAAAATTCTC


invisible?    
Gene introns: 0  

>3826 174 478     9q31.3    chr9:111593177-111593350 BLAT!
AGCCTCTGGGAAGGCACAGAGAAGATGGTGACCAGCATCACGGTGCAGCAGATGATGGCC
TGGAGCTTGGACCTCTGTAGAATCCAGTGAGAAAGCAGAGGTAGAAGAAGGCTCAGAGAG
AAGAGCTACTTTGGGTCCCCGGGAGGCTGGTAAGACGTTGAAGGCAGAGATTAA


invisible?    
Gene introns: 0  

>1503 120 477     4p11    chr4:49093353-49093424 BLAT!
TTCCATTCCATTCCATTCCATTCCATTCCATTCTATTCGCGTTAATTCCATTCCACTCCA
TTCCATTACATTCCATTGCAATCGACTTGATTCCATTCCATTCCATTCCATTCCATTCAA


invisible?    
Gene introns: 0  

>12697 154 476     21q22.12    chr21:37192691-37192844 BLAT!
GCACAGAACAAAAGGCAGGGGAAGGAGGAATTGATCCTTTTTGCTTCCTGCCCACCCACC
TGAGCTGCTACAGCTCATCTGATCTCCTGCCCTTAGACTGGGAGCTACAACACCAGCTTC
CGTGGTTCTCGGGGCTTCGAACTTCTCCTAAATT


invisible?    
Gene introns: 0  

>21573 168 476     10q22.1    chr10:72798052-72797885 BLAT!
GGGATGACCAAAGCCTAGGTAGGAGAAGGTGGGCTGGGCAACTTGCCTGAGGTTACACAG
CAAAAGGGAGGTTTAACCAGGCCTAGAATCCAAGCCTTGACAAACAGAGGGACCATTCTG
GAACCTTAGCCATTCTTTCCCTGCCAAGGTCATCAGGTGTGATGAATC


invisible?    
Gene introns: 0  

>7131 137 475     20p13    chr20:61773-61909 BLAT!
AAAAGTCAAAACCAAATGATAGTAACTTCAAAAAGATAAAGTAACACCAGCTGTCTTAGA
TGAGAAAGAATCAGCACACATTCTTGCAATTCAAAAAGTCAGAATGTCTCCTTACCTCCA
AACAATCATACTAGCTC


invisible?    
Gene introns: 0  

>11678 185 475     15q13.2    chr15:31105379-31105195 BLAT!
AAAGCCAAGCTCACCTCCTCATCACACGCCCTACAGGAGAAGCATCAGGGTGTCCGACTA
CGTGGGTTTCATAGCTGTGGAAAAGCCAAAGGGGAGACTCCTGAAGAAAGGTGGTGAAGA
CTGTGAAGAGCGGGTCAGGAAGATGAGCACAGCACTGCTACTCCTGTGGGCACAGGGACA
GCATG


invisible?    
Gene introns: 0  

>8378 124 474     2q36.3    chr2:228695355-228695478 BLAT!
AGTAAAATGTGGATTTTTAAGTCACAGTTTAATCTGTGAATTTGCTTTGTTATGCAGTTT
TGAAAGAAGTGATTTCATTTTTTTCTACAAAGGTGGCTTTCCTTAGTAGACTGTCCCTGC
CAGG


invisible?    
Gene introns: 0  

>10229 169 474     4_gl000194_random0    chr4_gl000194_random:163178-163346 BLAT!
TCACATATGATCTGCAAAGTGAGAGATTTACAAGAAAGTATTAAATTTGATCCATAGGAA
AGCAAAATCAAAAATCAATGAATTTTCCATTTGTAGTTTTCCCTAGGGGCTCTAATCTCA
AGATGGCTTAAATGCATTAGAATTCAATGACTAGGCACAATTGTTTGTT


invisible?    
Gene introns: 0  

>11059 169 474     2p24.3    chr2:13649732-13649900 BLAT!
TGTTGAAAGGAATGCAATGGAATCTAATGTGCAAACTGTGAAATATCTCAAGCTGCTAGT
TCATATAGCTTTCAAAAGATATTAAATATCTCTTCTTTTGTTTCAAAAAATGTAAACTGT
CTCTTAGAGTTATCTCTGTGGTTCTGCAGGATGCTTCAACACATAGTTT


invisible?    
Gene introns: 0  

>18104 172 474     9p21.1    chr9:32179040-32178869 BLAT!
TTTGAGTATAGAAAGATAAATTTTATTTTTTCATCACTGAAGTCTGTAATTGTGATGGGT
CAGATATGAAAATGGGGTGTTCTAAATGTCATTTCAATATCGTTCCTCTAGCTACATCAA
AAAAGAAGTTGAGTGGACCTCTTCACCTCATCAGGACACCGCCCGGGAGAGG


invisible?    
Gene introns: 0  

>18577 174 474     22q12.1    chr22:27295345-27295518 BLAT!
GATTAAGAACCCGCATGCATCCCGATGGGGAGAAAAGAGACCTGGGCATGGAGCCAGGAG
GTATTTACTCTAGTTCTGGCTCTGTCCCTAAATAGCTGGGTGACCCTGGCAAATCTAGTC
CCCTCTCTGAATCTCAGCTACTTCCATTATCACACACAGGGGTTATAGTAGCTT


invisible?    
Gene introns: 0  

>14192 164 472     10p15.1    chr10:3990788-3990951 BLAT!
TCCCAACACCCCAGGGCCTCTAGTCCTTTTCCAGCGTTGCCTGAAGACACAAACTACTGA
TGGCTGCATCCACATGACTGACTTCAAACACAGCACGCTGCAGGAGAAAAGCCGGATACG
CGCGTGGAAAGTGGGTGGCTCCACCACCCTGCTGTTCAGGTTTT


invisible?    
Gene introns: 0  

>602 113 470     1p31.1    chr1:73429100-73429212 BLAT!
GTGAAAATGGCCATACTGCCCAAAGTAATTTATAGATTCAATGCTATCCCCATCAAGCTA
CCATTGACTTTCTTCACAGAATTAGAAAAAAACCACCTTAAATTTCATATGGA


invisible?    
Gene introns: 0  

>5818 157 469     13q14.11    chr13:44638189-44638345 BLAT!
GATGATGATGCATTTACTGAGATCAGGAAGATAAAAAACAGACTGCGGTGAGGAAATCAA
AAGTCTGCAACATATCAGGTTTGTTATGCTTATGAGACACTGCAGTGAAGCACTGAGTAG
GCATTTGCATATACTCACTCGTTAACATATATTTTTG


invisible?    
Gene introns: 0  

>12313 208 469     18q23    chr18:75927170-75927377 BLAT!
GATAGTAAAGAGTCAGCATATAATATTACACAAAGAGATTATATAATTGTGTTTACGTAA
TACATATTGTATATACAGTATTACATAGGGAAAAACACGCACAAGTAAAAACCACCAGAA
ACATATTTTATATGGAAAAATGAACACAATTTTAAAGTATGTAAAATAAATATTGAATCA
ATAAAATGAATACCTTATTTTTGGCTAG


invisible?    
Gene introns: 0  

>8440 197 468     10q11.22    chr10:48472573-48472769 BLAT!
TGAGAACACACATGGCCAGTCAACTCTCTGGGTCCTCCATCCATGAGCTTCGTCATGAGA
CACCCCGAGGATAGACATTACCTCCCATGCAGCACCATGGGGGATGCTCGGTCCCCTGGA
GAATGGCCAGATTTCTCTGGGGCTTTGTGAGGACTCCTGTGGACAGGGCAAGATGAAGCT
TGGACCAACAGCTGCAT


invisible?    
Gene introns: 0  

>19914 125 468     13q33.2    chr13:106825923-106826047 BLAT!
GGGGACATGGGCCAGGGCAGCAGGTGGATGTGTGTCTGGGCACAAGGAGTGAGAAGAAGC
TCTGCACCACCCCAGCAGGCTGCTGAGCCAGAGAGCAACAGGTGTGGCTTCCAGGGGGGA
TCAAA


invisible?    
Gene introns: 0  

>5784 169 467     10q11.21    chr10:45115086-45114918 BLAT!
TAGTTTGAAAGAGATCAGAAGGAAGGTTGAGAAGAATAAGTTAGAGATAAAATGGAGAGC
TCATTTCTGGATATGTGGCACTTGAGGGGCCTAAGAAACAACACTTGGTAGGTGAGCAAG
AAGGCAAGCATTGAGTCAGGCCTGAGTATGAGCACAGCCACCATGGAGA


invisible?    
Gene introns: 0  

>17115 156 467     12p13.31    chr12:5491594-5491439 BLAT!
TAAGAAATGGCATCCTAAAAGCGGCCCACGTTTAGTGCCCACTGCTCTAGGGTAGAAGTT
CCTAATCTTTTCTGACTAATTCAGGGTATCAGTGAACTTAGGTTGGTAAAAACGACATTT
TTGTTTTCACTAAACTCTAATTGAAATTTAGCATTT


invisible?    
Gene introns: 0  

>3066 181 466     17q22    chr17:53599897-53599718 BLAT!
GTTCCCCTGCACAAACTCTCTTGCCTGCCTATATGTAAGATGTGAATTTGTTCCCCATTC
ACCTTCTGCCATGATTGTGAGGCCTCCCCAGCCACGTGGAACTGTGAGTCCATTAAACCT
CTTTCCTTTATAAGTTATCCAGTCTCAGGTGTGTTTTTATTAGCGATGTGAGAACACACT
G


invisible?    
Gene introns: 0  

>12763 156 466     4q12    chr4:59160162-59160007 BLAT!
AGCCTATAAACTCTCCTTACAATTCCCTCATTTTACCTGTCCAAAAACCGGACAAGCCTT
ACAGGTTAGTTCAGGATCTGCACCTTATCAACCAAATTATTTTGCCTATCCACCCCATGG
TGCCAAACCCATATACTCTCCTATCCTCAATACCTC


invisible?    
Gene introns: 0  

>12588 167 465     1p21.2    chr1:100797547-100797381 BLAT!
CATCTTATTATTTTTGCTTTTTGCATTGCTGTTGTTTACATTACATATCACAACAAAAGG
AAGATTTTTCTTCTGGTTCAAAGCAGGAAATGGCGTGATGGCCTTTGTTCCAAAACAGTG
GAATACCATCGCCTAGATCAGAATGTTAATGAGGCAATGCCTTCTTT


invisible?    
Gene introns: 0  

>18054 120 464     17q11.1    chr17:25285133-25285014 BLAT!
TTGTATGTCAGGAATTAAGCAAACAGGCAAATACAACAAACAAAGAAAAACAAGTAATCA
TTATCCAGCAAAATATGTCTCTAGGCCATGCAGACTGGCTTTGTGCTGGGTTCTTTAAAG


invisible?    
Gene introns: 0  

>19800 193 464     3p25.1    chr3:14270030-14269838 BLAT!
ATGTCTTTCTGCTGGAGTCTTACCATCCATACCAGCAGTCAAAAAATTTAAAGTAAATAA
GGCTAAATGTAGTTTTGATTAAGGTGGTAGTTGGCCTCCTATACCCCTTTTTTGTTTTTT
CAGCATGCGTTGTAATATTTGATGTGCCTGTTCTATAATGCCTTGTCCTCTAGGATTATA
AGGAATTCCTGTT


invisible?    
Gene introns: 0  

>4504 130 463     4p11    chr4:48556977-48557106 BLAT!
ATTACCGTTCTCTCTGCCCTGTTTTTTCCTCTGTAAAACTGCAGTGATCTCACCAAACTC
ATAGATTCTGAGATTTAAATAATGTGGATGAAGTGCTTTTACCATGCCTATAATAAGCAC
CCATAATAAG


invisible?    
Gene introns: FRYL (48499379 - 48782316)  

>13547 172 463     11q12.1    chr11:55826655-55826826 BLAT!
CATCATTCTTAGCAAACTAACACAAGAACAGAAAACCAAACACTGCATGTTCTCACTCAT
AAGTGGGAACTGAACAATTAGAACACATGTTTCATGTGCATCTGTGTGAAGAGACAACCA
AACAGGCTTTGTGTGAGCAACATGGCTGTTTATTTCACCTGGGTGCAGGCGG


invisible?    
Gene introns: 0  

>22016 153 463     4q28.1    chr4:127468851-127469003 BLAT!
CCTCAGGGTAAAATGGTATTCTCAAATTAGCTTTACTATTTCTAGATGAATATATTACTT
TGGGTTTATTTTGTAATGAAAAAGAATACAGATTTAATTATGGTCATAGTCAAATGTGTT
CTCTGAGAAAGATACGGCAGTGTCCTTGCACAT


invisible?    
Gene introns: 0  

>10657 127 462     4q12    chr4:59160874-59161000 BLAT!
TGGGACACGGCTTAGGAGGAATCCCAGAATGCAGGCATTCCTTGTCCCAGTGGCAAGATT
TCTGGCATTTGAAGCAGGATCCTGAAGGAGGAAGTCCTGTGGGAACGCTTGACTTCTGTG
GCTTAGG


invisible?    
Gene introns: 0  

>11336 157 462     2q32.3    chr2:196004716-196004564 BLAT!
GGTAATGGGTATTTTCTACCAAAGAGAATTTCATTCTAACACCTGTCTATCAGGTAGATA
TTAACATTTGCCTTATTTAATTGATGAAGAAACTCAAGCTAAATGAACGCAACTTCCTGC
AAGTCACCCAGCTAGGAAGTGGTTAGAGATAGGATTC


invisible?    
Gene introns: 0  

Shown 931-960 from 1945 sequences on 32 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs