Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 961-990 from 1945 sequences on 33 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>16902 188 462     10q21.1    chr10:60602771-60602584 BLAT!
CTACAGAGAATGCCCCTTAAGGGGACAGAACAGGCACCTGATTACCTGGTATCATACAAA
GGCTTTTAAAAATCAGACTTAAAAACTTTTCTAGAAAGGAGAACAGTTGATGCCTGATAT
TCCACCATTTGTTCTTCATTCCTTTGGATTAAATCATTATTTCTGGATAAGATACCAATA
ACCACTTT


invisible?    
Gene introns: 0  

>18064 167 462     10p13    chr10:14777166-14777000 BLAT!
AAAAGGCCGTTGGCTCTTGAGGAATAAATTCTGCTTATTTTATCCGCTGGAACGGACAGG
ACCTCAGAATGGACACCGAATTATGACCTAGTTTTGCAAGAGAAGCCTGGAGACAGCAGG
TGGATGACATCTTGCTGGACACCTGCAAGTGTGGCAGCTGATGCAGG


invisible?    
Gene introns: FAM107B (14560558 - 14816896)  

>4862 155 460     14q32.12    chr14:94605238-94605392 BLAT!
ACAGGGGAAGCGCTGATCTCTCCCTGATCTTCTCCATTGTCTTCTCTGACCCATTCCCTT
CACACCACTGGGAAGGGGCTCCCTGCCGCTCAGCCCTTTGCCCTCTGCCCCCTCTCCTCT
CCATTCCACATTCTCCTTCTCCTACTGCAGCAGGG


invisible?    
Gene introns: 0  

>8003 141 460     21q21.1    chr21:19910371-19910511 BLAT!
GCCATACATTAAAGATGAAGAAAAATATGGAAATAGCTCAAGTTACCTCCCCAACATTAA
AACAAACAACCCTCAGAGAAAACTCACCAGTTAACGAGGAACTAGAATTTTGAACGCACT
GTGAAAAAAACTAAAACAAAA


invisible?    
Gene introns: 0  

>20098 167 460     1p34.2    chr1:40696925-40697091 BLAT!
TTTTTAAATGCCACTGTTAAGGAGGTAGTGTTTTGTTTTTATTTTTCCCCCTAAACACAA
GAGAGAAGTCAGGGAATTGTTACGGAGGATTCTTAACAATTTTATCAGTTTGGGAGAAAG
CAGTGGTGAATATAGACAGCTTTTAATCTAGTTTTTGTTTTCTCTAC


invisible?    
Gene introns: RLF (40627040 - 40706593)  

>20956 165 460     19q13.11    chr19:35059170-35059333 BLAT!
AAAAAAAAACTCCTGCAGCTAGTTTGGTGTCTGCCCAGATGGCTGCCAAGTTTTGTGCTT
AAAACCCAGGGCCCTGGTGGTGTAGGCACTGGAGGAAATCTCCTGGTCTGAGGGTTGTGA
AGACTGTGGGAAAAGCATAGTATCTGGGTTGGAATGCACCATTCC


invisible?    
Gene introns: 0  

>22235 153 460     2p12    chr2:77915122-77915274 BLAT!
AATTGTTCTGAAATTTTCCAGATATATTTTTGTTATTGGTTTCTATTTAAATTCCTGGTA
ATGAGAAACCAAACTCTATATAACTTCAAATCTTTGATATTTCCTGAGACTTTTAAAAGA
ATCACTCAACATATGTTCCATCTCATTAAATGA


invisible?    
Gene introns: 0  

>1093 127 459     10q26.12    chr10:122112234-122112360 BLAT!
AAATCAATTTTTGTGATACATCATATCAACAGAATGAAGGACAAAAACCATATGATCATT
TCAGTTGATGCTGAAAAAACATTTGGTAAGGCTCAACATCCCTTCATGATAAAAACTCTA
AAAAAAA


invisible?    
Gene introns: 0  

>9548 158 458     10q21.1    chr10:55416040-55415883 BLAT!
GTTATAGCCTGGACTACATTGCTCTCTCTCATTAGAGAACCCTAACCTTCTTAGGAATGT
CCCAATATTCAGTTATAAAACTGCATTTCCCAAATTGCCTGGCACTGAGAAGTGATTGTT
TGATCCAACTCTGCACAATGGATTTTAAATGAAATTGT


invisible?    
Gene introns: 0  

>21344 195 458     9q33.1    chr9:122421343-122421149 BLAT!
CTCTGCCATTTTGTCTCTCAGTTCACTTTCTTCCTGAGTTCTGTATCTCTCACTAGTTAC
CAGCTTACTTCATATCTTACCATTCACCAACTTCAGAAAATGTTTCTACTCATGTCAACT
CTCCTTGAACTCCCAAGCACTCCTCAATCCACTGCAATCTGGCTTTTCCCCAACAGTCCA
CCAAATCTGCTCTTG


invisible?    
Gene introns: 0  

>18717 147 457     14q22.1    chr14:52705475-52705621 BLAT!
TCTCCCAGAGGAATAAAATGTGAAACATTTCCATTCCCATAGCACACTTCATCCAACTTC
CTTTTAGAGTAGGATGGAAACAAATTGCACTTTAGATCTATTCATGTTTGCTTCCAACGA
CAGGAAAATGTTCTGGATCCATTAAAC


invisible?    
Gene introns: 0  

>3724 154 455     4p16.1    chr4:6628844-6628997 BLAT!
CAATCATGGAAACTCTCTCAGACTTCTAATGTGAGAGTAAACAGAAGGAGCAAACTTAAG
AAACTAGTTCCATGTTATCTTCTAAAGTTAAAGATACTCATGCTCTAGACCCAGCAATTC
TGTTCTAGGTATGTAAGCTAGAAAATGATGTTTG


invisible?    
Gene introns: 0  

>14801 161 453     15q22.2    chr15:60025577-60025737 BLAT!
CTGTGATAGATGCAAAAAAGAAAGACAGAGGGTGCTATGAGAGCAAAGAACACATCTGGT
GCTATGATTTAAACGTCTCCCACAGTTTACGTGTTGGCAACTTAATCCCTAATGCATCAG
TGTTGAGAGGTGAGAACTTTAAGAACTGCTTAGGTCTCATG


invisible?    
Gene introns: 0  

>18238 178 453     1p32.3    chr1:53346566-53346743 BLAT!
GCTAAGTCATGCTGAGACTCCTGCCCCACAGAAACCAGGGAATCATAAATGCATGTTGTT
TTACGCCACTAAGTTTGTGGTAATTTGTTACACAGCATAGAAAACTAGTGTAACATATAA
AATAAAATACTGCCTGACTTTCATTGTTGTTGTTAAAAGATAACGTAACATTGAGCAG


invisible?    
Gene introns: ZYG11A (53308182 - 53360247)  

>555 152 452     6p21.2    chr6:39926597-39926451 BLAT!
CTTTTTTTTTCTTTTTTCCGGCGTTCAAGATGTCGAAGCGAGGACGTGGTGGGTCCTCTG
GTGCGAAATTCCGGATTTCCTTGGGTCTTCCGGTAGGAGCTGTAATCAATTGTGCTGACA
ACACAGGAGCCAAAAACCTGTATATCATCTCC


invisible?    
Gene introns: 0  

>2740 145 452     10q23.1    chr10:86471701-86471557 BLAT!
CCAGGTGTCACCTCTGGAAGTGGGGTAGAATGGAGGAGGTAGCTAAGAAAAGGAGGATCA
TTTGAAAGCTGTGTAACTGTCAGATCTGGAGCTGACTGTGTGGTATTGTCAAGATGATAC
AATAAGGAGCCCAATTCCAGCTGGC


invisible?    
Gene introns: 0  

>17955 150 452     3p21.32    chr3:44127274-44127423 BLAT!
GTTATACCTAAGGATTCTTTGCCCAGCCCCATAATCTGAAGATTTTCTCATGCTTTTTTT
CTAAGTTTTATAGTTTTATATTTAAGTCCATTACCCATTTTGAGTTAATTTTTATGTAAG
AGATGAGATTTAAGTTGAGGTTCATTTTAT


invisible?    
Gene introns: 0  

>18405 188 452     5q14.3    chr5:86935386-86935573 BLAT!
AAAAACTTCTCAATAGATCAATCTTAGCTTCTACAATAGTGATGCTATCTATAGGAGCAA
TTGGAGAAGTCACAAATCTTGTGAACGCAAGCCACAGGATTTCTGAGCAGTAAGAGATTA
TAAAAACTATGCCTACGTTTTAGCAGAATTCAGGACCCTCTCATAATTCTAATCTTGTGG
CTTTTCAT


invisible?    
Gene introns: 0  

>19563 196 452     Xq28    chrX:149399694-149399889 BLAT!
TCACTTCTGTATGTGAAGCGAAGCTTCTCAACGATAGCCTTCATCTTGCCCACCTGCTCT
GGAGTTGCCATGATTTTTTCAGTAAAGGGCATCTTCCTTTTATCATCAGCAAAGGGTAAA
AAGACCAGCTGGAAGCCTGGAGGAGTCACCTGAATTTTCTGGTCATCCAACTCTTCTTCC
TGTGGCACCAAAGCCA


invisible?    
Gene introns: 0  

>8687 139 451     12p12.3    chr12:17975844-17975706 BLAT!
CTTTATTTTGAGCCTATGTGTGTCTCTGCACGTGAGATGCGCTTCCTGAATATAGCACAC
TGATGGGTCTTGACTCTGTATCCAGTTTATCAGTCTGTGCCTTTTAATTGGAGCATTTAG
CCCATTTACATTTAAGGTT


invisible?    
Gene introns: 0  

>24851 248 451 164374+,202842-,30549-     11q14.3    chr11:90716960-90716851 BLAT!
AAAACTTTTGAATGTGAATAAGCATTTTATTTTTACACAGAAATGGTATAATACACCTTG
ATATGGTATGACGAATCCTAGGAAGTTCAGGAAGACACAATTGAATTAATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTTCAAGGAGAATTTTCTATAATGAGTTG
ATGGAGAAAGAAGAATGCATGAGCCTGGTTTATGAAAGAAAATTAAAGGTAGAATTACTT
GAACTGAC


invisible?    
Gene introns: 0  

>16871 163 450     3p26.1    chr3:4024520-4024681 BLAT!
CCATTAATGCTAAACTTCCGCCACATGCAGATGCCATAGAAGATGACCCATTTGACTCTA
GGACTTCAGATGTAACTCTTATGGTGAAAGGAAAATCTCGGGGAATAACAGGATACAAAG
CTTTCTCAGCAAGAGCACCATGCCCAAGTTCTCTTCTATTTAA


invisible?    
Gene introns: 0  

>17133 132 450     6q16.3    chr6:102604688-102604819 BLAT!
AAAACTAACAGAAGGGACAAAGACAGTCACCACATAATGATAAAGAGGTCAATTCATCAA
GAGGATTTAAGAATTTTAAATATATATGCACCCAACACTGGAGCATCCAGATATATAAAG
AAAATATGATTA


invisible?    
Gene introns: 0  

>4138 161 449     1q23.1    chr1:158145607-158145767 BLAT!
TTCACATCTTCTGGTCCAAGCAGAGTTCTAGGACCATGACTCTGCTTGCTGTTGGTCAAA
TTCACCTATTAGCCTTTTGATGTGAGCCAGCTTGTTATGAAGATATTCACATCTGTATTT
TTCTTCATGGTAATTGGGACTAGACTGCTTTATCTTCTGAT


invisible?    
Gene introns: 0  

>11977 163 449     5q34    chr5:167967800-167967638 BLAT!
CCTGAATCTTAAAAAGACTCTTATCGTCTAAGAGCAAACTTCAAATTAGAGGTGCCCTAG
GATTTTTCACATATCAAGAGCCAGTGACCAGCCAAACTTGGGAACAGAGAATCCAAGAGT
TAGCAGGAATCTCACAGACTGCTGAATCAAACTCAAGATTTGT


invisible?    
Gene introns: 0  

>16543 152 449     1q42.3    chr1:235080164-235080314 BLAT!
TTTTCTGCACGTGAGAGGGCAACAAAAAAACTGACCCCAGGGTAGGTCTAAAAGCCCCCG
ATTCCTTCTCCCATCTTAGCACCCCTTTGACATTAAGTCAAGCCATTCAACCTGAGTAGA
AATAAAATAAGAATATCAAAGTAGTGCCTGCA


invisible?    
Gene introns: 0  

>17589 155 449     2q34    chr2:210044008-210043854 BLAT!
GGTGCTGCAGGTAGGCCGCTGCATTTGCCTGAACAGATGGGAACTGGTGCTGAAGCATGT
GAATGACCTCAGGCAACTCAGGATCACGCCAGGCAAACTCCCTGGGGTCCTTCTGAATGC
TGTCTATTGATGGGGATCTTGTGGTGCCATCATCA


invisible?    
Gene introns: 0  

>7655 179 447     1p22.2    chr1:89755453-89755630 BLAT!
GAGGTTAGCATCACATTGTCATAATCAAATTCTTCATCAAGTGAAAAAAGTTGAACTTCA
TCTCCAAGTATCTCTTCCGTCTGTTTGTCCATTCTTTTAACACTGGGCTTTGGCTTCACT
TCACAGGTAGGAGGCTGGGCCACAAAAGGGATACAGGAAGGAATGCTGGTGCTTACATC


invisible?    
Gene introns: 0  

>12782 164 446     14q31.1    chr14:79503485-79503648 BLAT!
TTATGTAAAACCCCCAGGAGATTCTATAAGATATCAGGGAAGATTCACCTAAAGATTAGG
ACCCTTTGAGCCTGACAAATCTCCTGTTGAATGCCTTGCTTTCAACCAAAGCTGAGATAA
AAAGTGCGCGCATGTGCACACATGCTCAAATACACAGGCAGAAA


invisible?    
Gene introns: NRXN3 (78870092 - 80330760)  

>699 120 445     1p21.1    chr1:103753352-103753471 BLAT!
TCTGTGAAGAAAGTCATTGGTAGCTTGATGGGGATGGCAATGAATCTGTAAATGACCTTG
GGCAGTATGGTCATTTTCATGATATTGATTCTTCCTATCCATGAGCATGGAATGTTCTTC


invisible?    
Gene introns: 0  

Shown 961-990 from 1945 sequences on 33 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs