Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1021-1050 from 1945 sequences on 35 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>8875 120 427     1q25.1    chr1:173110741-173110622 BLAT!
TCATCGAACAGGGCATTAATGTTTGTCTCTGCCAATCATATGCCAAGAACATGGGCTTAT
ATGGTGAGCGTGTAGGAGCCTTCACTATGGTCTGCAAAGATGCGGATGAAGCCAAAAGGG


invisible?    
Gene introns: 0  

>12389 215 427     2q22.3    chr2:146163155-146163369 BLAT!
TTAACAGTCCCAGGTGAATCTAATAATATGAACTGGAAAAAAACAATAGTATGGAGAGTA
ACCAATAGCTTAATATTCCATTTTCTAGTGCTTCTCTACATTAATGTGTATATGAATCAA
TGGTTATCATATTAAAATGCAAGTTTTAACTCATGAGCTTTGGACTAGAGCTTGAGACTC
TACATTTCAAGCAAGCACATAGGTAATACTGATTG


invisible?    
Gene introns: 0  

>20203 117 427     5q14.3    chr5:89328758-89328642 BLAT!
TATTTCATTAAGTTGAATTTCAGTCTCTGATATCCTTTCTTCTACTTGATCGATTTGGCT
ATTGATACTTGTGGATGCTTCACGAAGTTCTCGTGCTGTGTTTTTCAGCTCCATCAG


invisible?    
Gene introns: 0  

>21558 171 427     9q33.1    chr9:120366473-120366303 BLAT!
TTCCCTGTTTTATCCACGTTTTTAACTCCTTCTGCAAGTTTCTACTGCATTGTTCTGATT
CTGGAGACCTGTAACTATAGGTAGGCCTCCATCTGCAATTGATGCCTGTCTTAATTTAAT
GTCTTTGTTTCCCACTGGTCTCCTTTCATCCTTTTTTTCGAGAAAGTTTTA


invisible?    
Gene introns: 0  

>6232 173 426     14q22.1    chr14:52619087-52618915 BLAT!
GCAGATGGAAGAGCTTTTCTAGTTTTATAGTCTCCTCCATTGAGGATATTCACCTCAAAA
TTCTATCATCTTTCGGCCAAAGATTGCTAGAGGTCTGCTCTGATATCTCACCCTTCCTAA
GGTGGATAAACTAATGACACCCCCCATACCATGAGTTTAAGAGGCCTTAGAAA


invisible?    
Gene introns: 0  

>13892 163 426     21p11.1    chr21:11112377-11112539 BLAT!
AGCTGAGGTCGCACCACTGCACTCCAGCCTGCTGGACGACAGAGCAAGACTCTGTCTCAA
GAAACAAAACAAAACAAAAACAAAAACTTAAACACCAGGGAACACACACAACACACATAC
CAATAAGATCATGAAGAAGGAACGGCTGAAAAGTCCACCAATT


invisible?    
Gene introns: 0  

>22309 170 426     2q24.1    chr2:157726474-157726643 BLAT!
CAGAGAAACAAGCAAGAGTAATCTGCCTTGATAAAGCAAAGGGCTGTGAGTAGCAGAATT
ATACTAGAGCAGAAGTAACAAGAATGGGAAGAAGGAATCCGCTGAGAGTGGGGAAGCTTA
ATGAGAAAGCGACATTATTATGAAGGAAGGAGAAAGAAATTAGTTAAATT


invisible?    
Gene introns: 0  

>22236 157 425     3q12.3    chr3:101418446-101418602 BLAT!
GAGACAGACTCATGAGCTTAGAACATTGTTTCCAGTTACAGTGTGACTGGAATACGTCAG
ATTTTTGTATTACACCCCAAATTTATAATGAGTCTGAGCATCACTGGGACATGGTTAGAC
GCCATCTACAGGGAAGAGAAGATAATCTCACTTTAGA


invisible?    
Gene introns: 0  

>670 116 424     20p11.22    chr20:22279102-22278987 BLAT!
CCATGGAATACTATGCAGCCATAAAAAATGATGAGTTCACGTCCTTTGTAGGGACATGGA
TGAAATTGGGAATCATCATTCTCAGTAAACTATCGCAAGAACAAAAAACCAAACAC


invisible?    
Gene introns: 0  

>14423 109 424     4q32.1    chr4:156770979-156770871 BLAT!
TGCAGTTACTTTCTTCTAAAGTTTAAGTTGACTGGCTTCAGTTTGCCGGACTTTAAGAAA
GCACAGCTTAGTTTTCAGTGACTCCAAATTAGGAAATATGGGGGAAAAA


invisible?    
Gene introns: ACCN5 (156750880 - 156787425)  

>17905 138 424     13q33.3    chr13:107096509-107096646 BLAT!
ACATGCACCAGACCAGGATAAAACCGTGAAATCTGATGTCATATTTTCATAAGACATAAT
TGCAAATGATATTCTAAAGCAGATTTGTTAAACGTGTGATCTAAATTATAAGTTCGTTGG
AAGTGATTATGAAACCTT


invisible?    
Gene introns: 0  

>15073 134 423     Xp22.13    chrX:17451663-17451796 BLAT!
GCAGAGTTAGTCCACACACAGGCCAGGCTCCTTCCTGGATGCCTAGAGGAAAGGTGGCAG
GTCAAAGGGAGATGGATGCCAACTGGCACCTGAAAGGATCCCTGCACTTGGTTTAGGATC
AGATAACATTTGAC


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>7292 111 422     3q13.13    chr3:109791329-109791439 BLAT!
GGTAGAAGCCTGCTACAAGGTTGAAGCCCTTACCAAGGGCAATGACAACAGGAAATGTGG
GGTTGTAATATCCACACAGGGTTCCCAATGGGGCACTGCCTAGTGAAGCTG


invisible?    
Gene introns: 0  

>23685 195 422 39250+,202399-,4784-     2q36.3    chr2:227256723-227256598 BLAT!
CCTTCCAGGGTTTTCACGGAATGCCCGAGAACCTATATCATGGAATGTCACCCAGCCCAT
ACATGTTCCCCTATATGGGCTGGGTGGAGACTCGTATAACCTCCTGGCTCTGGATGACCT
CTGTTANNNNNNNCACATACAGGCTCCTTAGATCCACCTCTGTATATTTCTTGGCTCTCT
TGTACCTCGGCCGCG


invisible?    
Gene introns: 0  

>9550 160 421     10p13    chr10:14777518-14777677 BLAT!
GTTTCAGGTCCATTTTGGTGAAATGCATCATTAACAGATAAGCAAGAACATTTAGGACAA
AAGATAGCGTGCTTTAGAATGACTCTAGGAAAAATTCTCCAATTGCAAGGGGATAAAGCA
TTGGCCTGCACTGTTCAGGAAGAATGGGAAAACTCCTTTT


invisible?    
Gene introns: FAM107B (14560558 - 14816896)  

>9691 171 420     6p12.3    chr6:51661957-51662127 BLAT!
CTATGAGAGACTGTTATTATTTCAGTTCTTCTGCATTTGCTGAGAGTGATTTACTTCCAA
TTATATGATCAATTTTAAAGTAAGTGCTGTGTGGTGATGAGAACAAGGTATATGCCTTTG
TTTTTTGGTGGAGAGGTCTATAGATATCTATCAGGCCCACTTTATCCAGAG


invisible?    
Gene introns: PKHD1 (51480144 - 51952423)  

>3627 160 419     12q21.2    chr12:79187439-79187302 BLAT!
CCGGGCAGGTACGCGGGGCACGAGCTAATGTTGACAAGGTATTTTTTGATTTAATGAGAG
AAATTCGAGCGAGAAAGATGGAAGACAGCAAAGAAAAGAATGGAAAAAAGAAGAGGAAAA
GTTTAGCCAAGAGAATCAGAGAAAGATGCTGCATTTTATA


invisible?    
Gene introns: 0  

>9816 124 419     Xp22.13    chrX:17451587-17451464 BLAT!
GCTCCCCACTAGACAACCACAGCATTTCCAGCTATGAACCAAAGAAGCACAGCAACAGTG
ACTAGCTTCCAATCCCAGAACTCAAGTCAAATATTCCATTATTTTTCAGACAACCAAGGG
GCTT


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>11089 189 418     2q32.3    chr2:195078484-195078672 BLAT!
GCCTTTATGAGGACATTGGCTTTTATTCTGGGTGAAATGTGAAGCTACTGGTGTAATTTG
GATGAAGAAATTACATGAATTGACACATTCATTTTTAAAGGCCACCAAGTTATCTATATG
ACTAATGGGTCACCAAGCTATTATAAATATAGAAGCCAAGAAGTCCTACATGAGCCCTGG
GGCATTCAA


invisible?    
Gene introns: 0  

>10962 129 416     6p25.3    chr6:933241-933137 BLAT!
TTCTCTTTCAATTCCTTTTTAATTTTTTTGCCATTTTTCTGTTGTTCCTTATTTTTCCTT
TCCTCATCTCTTTAAGGAAGTATTTTTTAAAAATATTCTGAGTACCAACAGAGGCCTGGC
CAGGCTCCC


invisible?    
Gene introns: 0  

>21002 169 416     2p12    chr2:76100450-76100618 BLAT!
CCTGTAATTGATAATTGAAGGTCTTCTCCATGACCCTATAACACTCCAATGCCACTTTGT
TGTGAGTGTAAATAAGGGCGTAGCCCAAAAGCACTGAGGCCACTGACAACCTATAGCTTT
CCTATCAAAAATCCTTAACCCAGTAACCCTTGGATAGGCCAAATGCATT


invisible?    
Gene introns: 0  

>18050 131 415     10q21.1    chr10:54303959-54303829 BLAT!
GGATTTGAGGAGGTGAAATAATTAGTCCAAGATAAGAAGATTAAAAAATGGTAACAGGAG
TGGATTCTAGATCTTAGTATTATAAACCATACAATATTTTCATGTAAATGAAACTCAAAT
TTTAAGTTAAC


invisible?    
Gene introns: 0  

>13542 131 414     12q24.21    chr12:115832732-115832862 BLAT!
GAAGAGAAAGATGAAAACCGGGGCCATTTTCTGAGCTTTCTAGACGTCATATGCTATACA
CATATTATGTCATTTATTTACTCAGCAAATACTTCTTGAGTCAGGCAGCCTCCTGTGGCA
CTGGGGACACA


invisible?    
Gene introns: 0  

>16305 173 414     2p24.3    chr2:15145669-15145497 BLAT!
TCCAGTCTGGCCTTTGCCACTCATGTGGCCATGGCCTGGGGCAGTCACTTAACCTTTGAA
ATAATGCCCATCTCCCAGAGTTATTCTGACTGTAAAGTAAAATGATGAAAAGGACTAGTG
CATTGTGTAAATGAATAACTAAATGAATCGCTCTTCCAAATAAATAATCCTAC


invisible?    
Gene introns: 0  

>3371 129 413     1q25.2    chr1:179548749-179548621 BLAT!
GTGAGCCACCGCGCCAGGCCCATCCTCTTCCCATTTCAATTCACCTTCCACCTTGTCCAT
AAAGTGACTCTTCTCAATTGCAAATCTTACCATTTTCCTTCCTTACAATGTTTCAATAGC
TTCTTTTGT


invisible?    
Gene introns: 0  

>22702 179 412     3p13    chr3:70528165-70528343 BLAT!
TTCCTATTAAGACATTTATCAATGACAATGCGTGCACAGTGGGACATGAAACTTCATCAG
CAATTCCAGTTTCACCCTGGCCTTGTGGCCTTGCCCTGCCCATTTGCCTTGTGATATTTT
GTTGCCTTTGAAGCATGTGATCTCTGTGACCCACACCCTATTCATACACTCCCTCCCCT


invisible?    
Gene introns: 0  

>4691 155 411     5q34    chr5:163025099-163024945 BLAT!
GGAAGCAGGCCCTCCTGAGACACCAGATCTACCTGCACCTTGATCTGGAACTTGCCAGCC
TCTAGAACCATAAGAAATAAATTTATTTTGTTGAAGCCACTCAGTCTGTAGTAATTTATG
ATAGCAGCTCAAACAGTCTAAGACAGTTATCATAC


invisible?    
Gene introns: 0  

>19142 138 410     19p13.2    chr19:8752120-8752257 BLAT!
CAAGCTCATTCCCATGGTGGTTGCAGAGTTGCTAGGAAAAGCAGAGAATATAGCCCTAAT
GCGCAAGAACTTCCCCTTGTGTCATGTTTGGTAATGTCTGATTGGCTAAAACAAGCCATA
TGGTCAAACCCAGACTCA


invisible?    
Gene introns: 0  

>8550 174 409     2q36.3    chr2:230955803-230955976 BLAT!
CTATAAATCATCTGGATCTTGTTAAAATGCAGAACATGACTCTGCAAGTCTGGGGTGGGG
CTGGAGATTCTGATGTTCTCATAAGCCCCCAGGTGATTCCCACGCTTCTGTTCTTGGACC
ACACTTTGAAGCCGGAATAAATGCCAGAGTCTCATTGGAAGAAAGCACCATGAT


invisible?    
Gene introns: 0  

>14961 165 409     5q31.2    chr5:137616417-137616581 BLAT!
CACACCCCCTACATAGCCTCATACTGAGGTCTCTGGGCTGGGGTTTTAGTGCCTGCTCAT
ATCCTTATCTCTCAAGCCAAAGCAACCCTTATGGCCCTAAATTCTCAAGAGCTTACCATT
GAGGCTCTTATAGATTTAACACCCAATACAGGGCCAACTCTGGAA


invisible?    
Gene introns: 0  

Shown 1021-1050 from 1945 sequences on 35 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs