Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1051-1080 from 1945 sequences on 36 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>22769 197 409     10q26.13    chr10:126971150-126970954 BLAT!
CTTCCTTCTCAATGCTCCATGAGCAGTCCTGTCCCCACCGATTGGCTCCATTGCCACCTG
CCCTCTTCCGCAGCCCAGTATCTGCAACCATCCTGACCAGAAGGCAAAACCATCTTAAAT
TAATTCTGTTTTCTGCTACAGTGTCATTAAAGTGCTAATGTAAATACAGTCTTTCTGTTT
TTAAAACAGTCCTAATA


invisible?    
Gene introns: 0  

>7586 179 408     6q14.3    chr6:87974510-87974332 BLAT!
CCAATAACAATTTTCAAAAACCAAAATAAAGACTTAATACAGCATACAAGAACACTCCTG
ATCCCACCACCCATCTGCTTCTTCAGCTTCACCTTCTTCAACTTCCTATCTTTCCAAGTG
GCCCACTGGCAATACCGCAATTACGCTCTACCCCCAAGTCTGGAATTCCCTTGTCCCCC


invisible?    
Gene introns: 0  

>7982 115 408     8q22.3    chr8:101804684-101804798 BLAT!
AATCCCAGCACTTTGGGAGGCCAAGGCAGGCGGATCACATAAGGCCAGGAGTTTGAGACC
AGCCTGGGAAACATGGCAAAACCCCATCTTTACTAAAAATACAAAAGTCAGTGGG


invisible?    
Gene introns: 0  

>15020 167 408     6q12    chr6:66803681-66803515 BLAT!
GCCAGAAGAAACTCCCATCAAGACTGAAGCAGACGTTTTGGCAGAAAACCAGGTTCTTGA
TAGCAGTGCTCCTAAGAGTCCAAGTCAAGATGTTAAAGCAACTGTTAGAAATTTTTCAGA
AGCCAAGAGTGAGAACCGAAAGAAAAGCTTTGAAAAAACAAACCCTA


invisible?    
Gene introns: 0  

>10147 119 407     17q22    chr17:52239056-52239174 BLAT!
CTACAAGCCAGAAGAGAGTGGGGGCCAATATTCAACATTCTTAAAGAAAAGAATTTTCAA
CCCAGAATTTCATATCCAGCCAAACTAAACTTCATAAGTGAAGGAGAAATAAAATACTT


invisible?    
Gene introns: 0  

>19790 123 407     2q33.3    chr2:207289925-207289803 BLAT!
CTGCCTTAGTTTTATAATCATAAAATATTTAGTAAAATCATATTTATGGGATCTGTAATG
AGATGGTAAATTCTTATAACAGTAAGCAAATTAAGATGCATAATTGTATATATAATATGA
CTA


invisible?    
Gene introns: 0  

>20529 187 407     11q14.3    chr11:88619035-88618849 BLAT!
ACATTCACCTGTGCAAGCTCTCAGCTCACTTGTCTACCTCTGCAGCTCAACTTTCCAGGC
TGCTCTTTGTTAGTAAATGATTTGGGGCTGCTTTTCATGAGGTAAAAAGTGTGACTGAGG
ATTCCCAAACCCTTGCTATCTCCCTAAGTGATTTCTTTTTAACTTCTATATCAAAGAGAC
TGGAGAT


invisible?    
Gene introns: GRM5 (88237743 - 88796816)  

>13436 170 406     16p13.12    chr16:13697720-13697551 BLAT!
TCTGGTTAATTGTCTCTCAGATAGACATGCTTGGATCTAAGCCTGGAAAGAAGTCAGCTT
TGAAGGTCCTGACTCCCAGGGTGATGGTAAGAATTATGCGGCTAGAGTAAGTAAAGTGCC
TTAGCTTATTAATTCATTCTTTGAACATTCAACCAGTATTTACTGAGTGC


invisible?    
Gene introns: 0  

>15389 157 406     16q22.2    chr16:72264476-72264632 BLAT!
CCAAATTTGCTCTTCCTGCTGTAACTTCCCATATCATCATCACCCATTTTGTTACCCCAA
GCCAAACACTTGGGAGTCATGATCAACACTTCCCTCTTCTCAACCCCACATCTAAGTAGT
CACCAAATCCTGATGTTCTAACACCTAGATATCATTC


invisible?    
Gene introns: 0  

>20919 183 405     15q21.3    chr15:53452469-53452651 BLAT!
TTGCCAGATGCCAGCCCTGCTCATCCAAGGTCACAGCCCTGGTCAGCTACGTGCCAGACC
AGAAGGGGCTGCTGTGGATCCGTGGGCCTTGAAGGCTTTGGTTTCTTTATTCTGTTTCCA
AATCAACCTTTAATTCTGCAAAATGACTTAGAATATTGACTTTAAAAATCAGCAGCTCCT
GGG


invisible?    
Gene introns: 0  

>13523 171 404     17p11.2    chr17:22020798-22020628 BLAT!
ACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTTCCGTGAGTGGTTAATAGGGTGAT
AGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGCTTTA
TGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCCC


invisible?    
Gene introns: 0  

>19155 170 404     8p21.3    chr8:19258938-19258796 BLAT!
AGCGTGGTCGCGGCCGAGGTACTCTGCGTTGATACCCTCCTAGGGAGCTGGGAGACTTTA
CAGGTTTTTTAAGTCAGGAGCATAGCTAGGAACCTTATGTTCATTACTTCAAACTTCTAA
GCTAGATAATATCATTACTTGGATTTTCCAGGTGCAGAGAATGAGGATCA


invisible?    
Gene introns: 0  

>20337 123 404     6q25.1    chr6:152008723-152008601 BLAT!
CTAAAATAAAAAATCAGGTTTTTTATTTGGACTGTGTGTTTTTATCTGCCACCCCAGATG
ATAGCAGAGTCTGGGACTCAGTTACATAGTTAATTGCCAAAATTCTTTATTCGTTCTTCT
CAG


invisible?    
Gene introns: 0  

>20795 126 404     21p11.2    chr21:10822444-10822383 BLAT!
ATTCCGTTCTGTTCCGTTCCATTCCATTCCATTCCATTCCATTCCATGCCGTTCCGTTCC
ATTCCATTCCATTCCACTCCATTCTACTCTGGTTAATTCCATTCCATTCCATTCGATTGC
AATCGA


invisible?    
Gene introns: 0  

>24244 190 404 100028+,203684-,94072+     1p36.12    chr1:21911009-21910881 BLAT!
CGCGGCCGAGGTACAGTGGCATGATCTCGGCTCACTGCACCCTCCTCCTTCTGGGCTCAA
nCTATGTTGCCAGGCTGGTCTCCAACTCCTAGGCTCAAGCGATCCACCCACCTGAGCCTT
CCAAAGTGCTGGGATTACAGGTCTGAGCTACTGTGCCTGGCCCTCAGTGTTTTAAAACAC
GGCACCCGTG


invisible?    
Gene introns: 0  

>10641 134 403     1q32.1    chr1:201072178-201072312 BLAT!
CCTGACCAACATGGTGAAACCCCGTCTCTACTAAAAACAAAAAAAATTAGCCAGGTGTGG
TGACGTGTGCCTGTAGTTCCAGCTATGCGGGAGGCTGAGACAGGAGAATTGCTTGAACCT
GGGAAGTGGAGGTT


invisible?    
Gene introns: CACNA1S (201008639 - 201081694)  

>18625 159 403     4q12    chr4:59158071-59157913 BLAT!
TTGCTGGCAGGGCACCCTCCAATACTTTCACCCTGATGAAGTCCTATTCTTTACTTTTAT
ACTCACTCTTATTATCCTTCCCATTCTTATGCCACCCTCTACCTCTCCCCAGCTATCTCC
ACCACACTATCAATCTCACTCACTCTCTCCTAGCCATTT


invisible?    
Gene introns: 0  

>19522 142 403     6q22.31    chr6:118748553-118748694 BLAT!
GCAGAAACCTCTGCAGACTTAAATGTCCCTGTCTGACAGCTTTGAAGAGAGCAGTGGTTT
TCCCAGGACGCAGCTGGAGATCTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCCTGA
CCCCTGACCACCAAGCAGCCTA


invisible?    
Gene introns: 0  

>4014 155 402     9p23    chr9:13770492-13770338 BLAT!
TAAGTCAACAGATAAAATGAAAATTATTTGTTGCTTATATATACCATGTGACTTTATGCA
TGCAGGGAAGTGTATGTCTATACATATGCTCACATCCATATGTATGGACCTGATTAAAGT
ATGACCTTGTTGTATATGTGTGTATGTGTGTCTCT


invisible?    
Gene introns: 0  

>6022 141 402     3p12.1    chr3:85256659-85256799 BLAT!
CTTCCTTCCAAGGAAATCTCAAATTTTACTACTATCAGCAGCCATCAATTTTACTGAATT
TGAAATTATAAAGTATTCTAAAACATTCTTGACTAAAGTATTTTTATCTAGTGGTTTAAT
GGTAAGCCTGAAAAGGACTAA


invisible?    
Gene introns: CADM2 (85008132 - 86123579)  

>22072 163 401     16q22.1    chr16:69791054-69791216 BLAT!
TATTCATACTCAAAGGAGCCAGGCTGTGCAAATCTGGGTGGCTGCTCTCGTTCCTTGTGA
AATTGCTGGTTTTTTATAACCAGCTTCTCTGGAAGTCCCTCTTCATCATCTAACTGGTCC
ATGGGCTCCACAGTCACAGGACGAGGAAATGTGGTTAGCAGGA


invisible?    
Gene introns: 0  

>14924 145 400     10q23.33    chr10:94843465-94843321 BLAT!
AAAACAGGATATTCCCATTACACATTCCTTATGTAAACCTGGATTTCTAGCACTTCCTGA
AACACCGAAAGAGTTTCAAACCGAGTTCTTCATTCCTGTAGGTCAAGAGTAGGTCAGCAC
TGAGCAGCAACTGCCCACTTTAGAG


invisible?    
Gene introns: 0  

>15359 126 399     18p11.21    chr18:14551588-14551713 BLAT!
GATCTGCCCGCCTCGGCCTCCCAAAGTGCTGGGATTACACACATGAGCCACTGCACCCAG
CCTATATAGTCATTTTTTAAGATAGAATTTTAATTTTAGAATAGGTTTAGATTGCTAGAA
AATTGA


invisible?    
Gene introns: 0  

>3388 149 398     9p23    chr9:10961569-10961421 BLAT!
AGCCCGAAGTGGCCAGGTTGCTATCTACTTTGTTTAATGGAATCATTGTTGTGTCTCCTG
GTGGCAGCATTCCTCCTTCTGGAACTAAGACCTCTAGGCCAGCAGAATGTAATGTCATGG
GAACAGGAAGCAAAAATTTTGCTAGTGGG


invisible?    
Gene introns: 0  

>6584 164 398     4q34.1    chr4:172681436-172681599 BLAT!
AAGAACCTTGGAAAAAGGATAGCCGAATTGCTAACCAGAATAACCAATGTAGAGAAGAAC
ATAAACGACCTGATGGAGCTGAAAAAACACAGCACAACAACTTCGTGAAGTATTCGCAAG
TATCAATAGCCAAATCGATTAAGCAGAAGAAAGGATATCAGTGA


invisible?    
Gene introns: 0  

>16472 176 398     4q28.3    chr4:135638781-135638606 BLAT!
GCAAGGTGCAGAATAGTTTGCTTAATTTAAATCTCCTTTCCTAGAGAGTCAACAACATAA
GAATTTGGAAAGCATTATAATGAGGTGGTTAGGAGCATATATTTGACATCAGACTGAAAT
ATGTTCAAATTCAGGCTCTGGCACATTATAGATGTAAGAATTTGGCAACTTGCTTA


invisible?    
Gene introns: 0  

>19118 143 397     8q24.13    chr8:123740566-123740424 BLAT!
CACACGGTGCTTGGGAGATTTTGGTTTTGAAGTTTTCCTTCTGAGGATTGCTTTAATTTA
TTGGGCATCTTGTTGCTGAAAAATACAATCAAGAAAGAAAACACACAAATGCCTTTTCCT
TCTACAAATGTGATGCTTAAATA


invisible?    
Gene introns: 0  

>1440 100 396     1q25.2    chr1:176327026-176327125 BLAT!
ACTAGCCACTGCAAAAACATGCCAAATTGTAAAGACCATTGATGCTAGGAAGAAACTGCA
TCAATTAATGGGTAAAACAACCAGATAACATCATGACAGG


invisible?    
Gene introns: 0  

>5311 150 396     14q32.12    chr14:93251231-93251380 BLAT!
TCTTGGAGAAATTTAGTTTATAATTTAACCTTAAAGCAAGGATGATAGTATCCCTTCCGC
AAACTACCCCCTCCTTTTCTGGAGACTAAAACCACCTTTTAAAAACTAACGAAAGGCTGG
CTAGGCGCAGTGGCTCACACCTGTAATCCC


invisible?    
Gene introns: 0  

>19204 194 396     2p24.3    chr2:13840017-13839826 BLAT!
GGACCACAGTATTATTGACATTTTAAACTCAAGAATCAATTGTCATAGGGGGCTGTCTTG
TGCATTGCACAATGTATGGCAGAGAGTCCTGACCACTACCACTAGATGCCAATGGCACTC
CTGCCCCATGAGTTATTATAATAAAAAATGTCTCCAGACATTGGCAAACATTAGCTGAGA
ATAAAAATTGTCCC


invisible?    
Gene introns: 0  

Shown 1051-1080 from 1945 sequences on 36 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs