Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1081-1110 from 1945 sequences on 37 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>9720 125 395     7p14.2    chr7:35742813-35742689 BLAT!
GCCAAGGCAGGTGGATCACTTGAGGTCAGGAGTTTGAGACAGCTTGGCCAACATGGTGAA
ACCATGTCTCTATTAAAAATACAAAAGTTAGCCAGGCATGGTGGCATGTGCCTGTAATCC
CAGCT


invisible?    
Gene introns: 0  

>11509 151 395     21p11.1    chr21:11186745-11186600 BLAT!
CTAATTTTTTGGATTTTTAGTAGTGACAGCCTTTCACTGTATTGGCCAGGATGGTCTTGA
TCTCCTCACCTTGTGATCCCCTTGCCTTGGCCTCCAAATTTGCTGGGATTACAGGCCTGA
GCCAAGATCCATATTTTTTAAATGAAAAAAA


invisible?    
Gene introns: 0  

>17958 133 395     19q13.43    chr19:57406678-57406810 BLAT!
CAGCCTCCCAAAGTGCTGGGATTACAGGCGTGAGTCACCTGACATGAGTCACCCAGCAGG
TCATACATTTCAATCATAATTTTCACTTCACTGATGAAGAAACTGAGGTGCAGAGATTAA
ATAACTTGTTCAT


invisible?    
Gene introns: 0  

>21463 158 395     4q35.2    chr4:189299750-189299593 BLAT!
AGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACCCCTTCTCTACTAGAAATACAAAA
CTTAGCCAGGTGTGGTGGCAGGCACCTGGGATCCCAGCTTCTAGGGAGGCTGAGGCAGTA
GAATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGC


invisible?    
Gene introns: 0  

>15583 158 392     4p15.31    chr4:19963698-19963541 BLAT!
CCTGCCTCGGCCTCCTAAAGGTGTTTGAATTTAATGTAATAAATATTCCACTGCAAATCC
TAGAACATTTTTATTCTTCTCTTTCTAGTTATTTCTGAGGTGTTTAAACAGTTCTACATA
GAGGTTGGTGTGTGTAGAACCGGACATATATTCTAATT


invisible?    
Gene introns: 0  

>21374 186 392     18q22.1    chr18:66066096-66065911 BLAT!
TCTTTGCCATTGTTCAAGTGCTACACCCTTACTCTCTTATACTTGATCCATTTTGTCCAA
TTTTTAGGGTTAATGGGCACCACTTTAATCCAATCCAAAATGTTTACCAATGGAGTGAAA
GAAATATTGATTTAATCATTTCTGTATGCAGAGTTTTAATAAACTGTGTTATTTAATTTT
AAGTGT


invisible?    
Gene introns: 0  

>5204 113 391     1q32.2    chr1:209406457-209406569 BLAT!
TGCGGGCTGGAGTCGGGGAGCTGCTCTGCCGAAGACCTTAAAATGGCCAGAAGTCTGGTC
CCCAAGGCTCTGGAGCCATACGTGACAGAAATGGCTCAGGGAACTGTTGGAGG


invisible?    
Gene introns: 0  

>5307 146 391     5q15    chr5:92434738-92434593 BLAT!
AATTTGTTTTGGTTGCAATCACACCCTTGAGTCTCTAGAAACTTTGAAGAAGAAGTCTTA
TATGTGCCAGTTGTTCTGACTCATCCATTCAATTCATTTAATAAATATTGAGCATCTGTA
ATGCACCAGACACTGTTCTAGGTGCT


invisible?    
Gene introns: 0  

>5423 164 391     5q12.3    chr5:64653527-64653690 BLAT!
CTATGAAAAATTATATGGCAGCAAATTGAATAAGCTAAAAAAATGGACAAATTCTTAGAG
ATACATAACCTATCATGACTGAATCATGATGAAATACAAACTCTAACAGACAAATAATGT
AAAAGGAGATCAAATCAGTAATCAAAAAAACTCCCAGCAATAAA


invisible?    
Gene introns: ADAMTS6 (64444562 - 64777704)  

>9200 141 391     12q23.1    chr12:98347892-98347752 BLAT!
CTCACAAGGATCCCTTCTCATGTGGCTCCATTCTCACATGGCTCCATTCTCACAAGGCTC
CATTCTCACATGGTTCCCTTCTCACCTGGCTCAATTCTCACAAGGATACATTCTCACAAG
GCTCTATTCTCTCATGGCTCC


invisible?    
Gene introns: 0  

>12948 139 391     2q35    chr2:218636733-218636595 BLAT!
ACAACAAAAACATTTTCCCTTTTAATATAATACAATAATCTCTTATAGAGAAAAAACAAA
CTCACTATCTTCCCCAAAACAGATGAGACACCTGAAGTCCCATCAGTAATTACAACTATC
ACTTGGTGATGAGCCTTCC


invisible?    
Gene introns: 0  

>14480 124 390     1p13.2    chr1:115682586-115682463 BLAT!
TTCAACTGACCCTCCAATGGCACAGCTCCCAGAGCCCCAGCACTCCGATGTGCCATTCCT
TTTGATATCACCCTTGAGTAATTCCCACAGTATTTAAAAAGAGATGCACAATTATTGTGG
ATAA


invisible?    
Gene introns: 0  

>18669 151 388     7p15.2    chr7:27550071-27549921 BLAT!
TCCCATCTCACTGTTACCTCTATCCCAGTGGAGCCTTTCCAGTGTTTGAAGAGGGCAAAC
ATTGATCTAGCCTGAAGTTAGAACAGGAAAATATGTGCGAGGAAAATGATGTTACCATTT
GCACTCAGTCATTTGGTCAAGAGTCAACCCT


invisible?    
Gene introns: 0  

>8943 159 387     11q14.3    chr11:91320315-91320157 BLAT!
ATGACTCCTAAAACATAATTTCTAATCTTGTGGTGAATGTTAGTCCTATAGAGGCAATCT
AGTCTCCAGGCAAGAAGTAGGTCTGCTTTGGGAAAGGGCTGTTACAGTCTTTGTTTTAAA
CTGTAAACTGTGAACTAAATTTCTCCCAAAGTTAGTTCA


invisible?    
Gene introns: 0  

>10442 147 387     1q42.3    chr1:235079366-235079220 BLAT!
TAATAGGAGGTGGGGCCTTTGGGAGGTGCCCTTGTAAAAGAGAGTGCAGAGCTAGTCCCT
CCCACCATGTGAGGACACAGCAAGAAAGTCCATCACTATGTATGAACCAGGAAGCGAGCC
CTCCCCATGTTAATGGATGGAAGGTCT


invisible?    
Gene introns: 0  

>20949 167 387     5p13.1    chr5:39719573-39719739 BLAT!
GATGAAAGTTGGTCTGCAACATGATTTTCAACCACATCATGTATTATCGAATCATTAGTG
GTTTCTGAAATTTTATGAAGAGGAAGAGGTTTAATAAGATCTGGCTGTGCTTGAGTTGTA
GGTGCAGGTGGTCCTTTTCCCCCAATATGATTGTTTACAACAGGATT


invisible?    
Gene introns: 0  

>4896 168 386     10q21.2    chr10:61760177-61760010 BLAT!
ACATTAATCCAACCATAAGGGCAGAGCCTCCATGACTTAATCTCTCCTCATTAGGCATCA
CTTCCCAACACTGTTGCATTGGGGATTAGGTTTCCAACACATGAACTTTGTGGGAAACCT
TCAAACCATAGCATCCACCAAGGGAGACAGGAGTAAAAATTAGAGATA


invisible?    
Gene introns: 0  

>10210 146 386     Xq21.1    chrX:80103852-80103997 BLAT!
CAGGAATGGACATCAACAGGCATTTATTAACCCTTAAAATTTTGTATATAATATAAAAGT
CACCAAACAAAAAGCCAAAGGTGAGGTTACAAAACTGACTTACCTACTTTTAACTTCTAT
ATGGCGAGCTACTGTGATCTTCGTTT


invisible?    
Gene introns: 0  

>17966 135 386     8q22.3    chr8:101695476-101695610 BLAT!
TGGCCAACACAGTGAAACCCCATCTCTACTAAGAATACAAATTAGCTGAGCTTGGTGGCA
CATGCCTGCAGTCCCAGCTTCTTGGGATGCATGAGTCCCAGCTTTTTGAGGCACAAGAAT
TGCTTGAACCCGGGA


invisible?    
Gene introns: 0  

>19105 184 385     3q13.13    chr3:110232462-110232279 BLAT!
AAAAGAAATGTATGCTTCTTCCCTTTTCTCTTTACATAAAGAGCAGGAATTAGTTTGTCA
TACCTAGAATAATCTCCTGGTGAGGCTTTGTGAGGTGCCAATGTTCTAGCCTCTGCCCAA
CTTACAAGTCTGAAACCTCAAAGGACATTTGGTCTTATTAAAGAAATAAAAGAGTAAGAA
TGGA


invisible?    
Gene introns: 0  

>21263 162 384     3p25.2    chr3:11802876-11802715 BLAT!
GAGGCAACTAGAAACTGCTAGACAGGAAAGATGGAGCGCAGTAGAGAAACTGGGGTGATC
AAGAGGGGAAAAGTGCCCTCAAGAAGACTGAGCAAACCAAGATCCCAAAGTCTATTAGGA
AAATCAATGATAATAAGATACAGGACCAAACAAAATCAGCAA


invisible?    
Gene introns: 0  

>21562 107 384     12q21.32    chr12:88691274-88691380 BLAT!
GTAGAGATGGGGTTTCACCATGTTGATCAGGCTGGTCTCAAACTCCTGCCTCATGATCCG
CCTGCCTCGGACTTCCAAAGTGCTGGGATTACAGGCGTGAGCCACTG


invisible?    
Gene introns: 0  

>9540 164 383     10p15.1    chr10:4343720-4343557 BLAT!
ACATTTATTAAAGCTGTGAAGCCTTCAAAGTGGATGACTTATGATTTTTCATCCTCAACA
ACGGTTTTGCCAGAATGCTGCTAGACTTGGGAAGGATGATTAACAGGGCAGATACTCACA
TTTAATGACAGCACACTACTAATTCATTCCAAAATAAGTTCACC


invisible?    
Gene introns: 0  

>13901 145 383     3p24.1    chr3:28005148-28005004 BLAT!
GACCTCAGAGGGAAAAGAAAGCAGCATCACCTTCTTGGTCCTAATTCTCTCTTTCATGAG
CCCTCTAAATTATCTCTCCCACCTCACTCCACTCCCTTTTTTAACTAAAACATAAAATTA
ATTCATGAATATGGCTTTTTAAAAA


invisible?    
Gene introns: 0  

>16338 156 383     6p24.3    chr6:7587710-7587865 BLAT!
TGAAATTAATTTTATGCATTAAATACTGAGTTCGCGTGCCATGCATTGTGCCAGAAGCCA
TGGAGTCTGTGCTAGAAATACATGGTGAAAAAGAGCCCTCATAATCCAAAAGGAAGAAGA
AAATGTGGTAAATGCTGTATTGGGAAAAATGAAGGA


invisible?    
Gene introns: 0  

>21918 131 383     3p26.1    chr3:7695105-7695235 BLAT!
AACAGATCTGAGAAGCCATTGGATTTCTCTGAGGAAGGTCTGTTTCTGAGGGTCATGTCT
ACTCTTGCCTAGCACTTTAGGCTATCTCAAAGTCCAGTCCCCAGAACCAGCCTTCCTCTA
ACCCCTGCCCC


invisible?    
Gene introns: GRM7 (6902801 - 7783218)  

>11799 152 382     14q21.3    chr14:48414075-48414226 BLAT!
TTTCAGTGCATGTTTTCTGGTTGTATAAAGCTTTCCCATGCAAGGGGGCTGATGTTATAA
CAGTAGATTATTATGCTACAGTGTATTTTCACCAGGTAAAGAAAGCTTTTTATGGTTCAC
AGAGGACAGTTCCTTCACAATCTAGAACCTAA


invisible?    
Gene introns: 0  

>14942 140 382     3p14.1    chr3:68634278-68634417 BLAT!
ATTTACATTTAAGGTTAATATTGTTATGTGTGAATTTGACCCTGGCATTATGATGTTCGC
CGGTTATTTTGCCCATTAACTGATGCAGTTTCCTCCTAGCATTGATGGTCTTTACAATTT
GGCATGTTTTAGCAGTGGCT


invisible?    
Gene introns: 0  

>16859 140 381     14q11.2    chr14:19983938-19983799 BLAT!
TTTTTTCCAGCTTCTAAGATGGCAGAGAACGATCACCAGCCTGAGCCTTATTTCCAGGTA
AGTAGCTGAATTAGAGTTTTGTCTTAAAATTTTTCCTTAATGAATAAAATGTAAGATTAC
CCACCAGCTGCTTTTAATTT


invisible?    
Gene introns: 0  

>20649 153 381     20p12.1    chr20:12894003-12893851 BLAT!
GAAAACCTGTTTGTATCTGCTGTTCACTTCGTTAGTGCAGATTCCCTTTCCAGATGCAAA
ACTCCGCCCCAAAAAGACAGCATTTCAAGATATTTCTGTGGTTTGCAGCCCTTCTGAGTA
TCCATCTTGAAATATGCTAAAAAAGTATATTTG


invisible?    
Gene introns: 0  

Shown 1081-1110 from 1945 sequences on 37 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs