Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1111-1140 from 1945 sequences on 38 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>4405 140 380     3q29    chr3:195213040-195213179 BLAT!
ACAGTGGTAGATATAGTGAAGCTGCTCTGTATGATATCAATAGTGGAGCTGCTCTGTATA
TCATCACAGTGGTAGTTATAGAGAAGCTCCCCTGTATGATATCACAGTGGTAGATATAGT
GAAGCTGCTCTGTATGATAT


invisible?    
Gene introns: 0  

>11682 174 380     Xq27.2    chrX:141675393-141675566 BLAT!
TTTATAGTCACTTTTTGAAAACCTTACTCTTTTGGCCTTCCTGGGGCTGACCGCTTTGAC
TCAAAGCATGTAATTTGTTGCAGAAAACCAGAATTACAAAACTACTGCGAGAAGTCTAGC
ACAGTAAAACAAGGGCAGAGTCACTCAAGAAGACTACTTTCAAGAATTCTGATT


invisible?    
Gene introns: 0  

>17446 152 380     17q24.3    chr17:69480462-69480613 BLAT!
ATTTTCACTTTTCTACAAGGGAAAGGGGCAATAGGGGAACTGAGTTTCAGTAACCTCTGA
GCCACCATCATGAGAATTTGTGTAACCTACAAGAGGTCTCCCCTCCCTTCGTCCCTAAAA
AATATGATTTAAGAAGTAGCTTCCCTTCACTT


invisible?    
Gene introns: 0  

>9752 144 379     5q13.1    chr5:68023663-68023520 BLAT!
TTTCCCAGAAAGCTCAGTCTTCAGTGACCTCTTACTGTGTTTAAGTCCTTTCCATCCTTC
AAGTCCCCGCTCAAGAAGCCACCTCTTTGATAAGCATTTCTTGTATCCTTCCAACTGGAA
GTGACAGACTCCCTCTCTGGACCC


invisible?    
Gene introns: 0  

>9822 166 378     13q21.1    chr13:57900071-57900236 BLAT!
CTTTCATATCATTAACAACATGCTCATATTTTACTTTTAATATTTTTCCTCTTTTCTGCC
TTATTTACTTAATTATCTAACTTAAAAATTTGCTAATCATTTGTTGTAGGGATTTAAGAC
TCTAAGCTGTTTATAGGTAGAAGGATAGGAGAGGTGAGAATTATAA


invisible?    
Gene introns: 0  

>10356 157 378     17q25.3    chr17:75975080-75974958 BLAT!
GTTAATCTTGCATGCACAAAACTGTGGAGATAGGCTGAGGCTGTGAATGTTACCTTCCTC
TAGAGAGGATTTAGTTTTGCTTCTGACAAGCATTTAAGAGCAAGGGTGAATCACTTTAAT
CTACCCCCGTACTCAAATGGGTCAACGTTCTTCAGCG


invisible?    
Gene introns: 0  

>19937 186 378     1q32.3    chr1:214308002-214307817 BLAT!
CATGATTCAAAAAAGGAAAAACATTGATAAATTGAATAAAAATCAAACTACGGATGGGGA
GAAAGCATTTAAAAATTGCATGTTTGAAATTTAATCGCATGTAGACTATATGGAGAACTC
TCAAAACCAAGTTTTTTTTTAAAAAAGCAAATAAACAGTTCAATTATAAAATAGACAAAA
AGCATG


invisible?    
Gene introns: 0  

>21275 155 378     13q33.1    chr13:103927755-103927909 BLAT!
TTGCAGTTAATAAACTTCAGAGCCTTGAGTTGAAGCTACACTGTCTAGGGATCACAGAGG
TTACCAAACTTCCTGAAAAGAGCTTAGATAATCAGATAGGAAAACAGACCAGGTCCCTGA
AGGCAGGCATTGTATCTCTCTTGCTTACCACCGCA


invisible?    
Gene introns: 0  

>5066 145 377     14q31.1    chr14:83393407-83393551 BLAT!
TTTGTCCTTGATTTAGCACTCTTCCCTGCCAGGCTCCATAACCCAGGAATTGCAAGGCAA
GGTTAACCGTGAGAAAGGACTCACTTGCAACCCAAAGCAAGTGAATTTGAATGGCTCCAC
AGGTCATCAAATCATTAGGTCTTGG


invisible?    
Gene introns: 0  

>22632 111 377     4q32.1    chr4:156770044-156770154 BLAT!
TAAAACTTTTATTTTGAGCTACAATTTAGAATACTCCTATGAACAAAACGTGGAGCATAC
TTTATCCTGTCTGCCTGATTTCTCCAGAATTTGGAAACTATTTGTGGGTAT


invisible?    
Gene introns: ACCN5 (156750880 - 156787425)  

>15048 105 376     17q24.3    chr17:69647446-69647550 BLAT!
CAGATACAGATGCTCATTTTTCCAGCTTCCCTTGAGGCCAGGAGTAGGAATGCAACCAAT
TAGACCTAAGGAGAAATCTGCTCTGGGACCTTTGAGGTAGAATTA


invisible?    
Gene introns: 0  

>20769 157 376     9q33.1    chr9:122420870-122420714 BLAT!
TCATGCCTGTAATCCCAGCACTTAGGGAGGCCGAGGCAGGTGGATCACGAGGTCAGGAGT
TCAAGACCAGTCTGGCCCATACAGGGAAACCCCGTCTCTACTGAAAAGACAAAAATTAGC
AGAGCATGGTCATGGGTGCCTGTAGTCCCAGCTACCC


invisible?    
Gene introns: 0  

>20909 165 376     3p26.2    chr3:3806348-3806184 BLAT!
AGAAGGGTATAGTGAGGGTCCATATCTCCTGGCCATCTAACTCAAGACATTTTCTGGATT
TCACCACCTCTTGATAGGAGGTATGACATTGGCAAACCATTTCATAAGACCTTCCTTCGA
TCACCCTTCCTAGCCACCTTCCATCCTGCCCTCTTTTGTTGCAAA


invisible?    
Gene introns: 0  

>22268 161 376     18p11.21    chr18:15105515-15105355 BLAT!
TGCACCTATCAACCTATCACCTAAGTATTAAGCCCAACATGGATTAGTTATTTTTCCTGG
TGCTCTCTCTTCCCCTGCCACCTGCCTCTAGGCCCCATTGTGTGTTGTTGCCCTCCCTGT
GTCCATGCGTTCACATTGTTCAGTTCCACTTATAATTGAGA


invisible?    
Gene introns: 0  

>13531 158 375     3q22.1    chr3:132106328-132106171 BLAT!
TGTAGATAATACCCCTACATTCCAAACACTCCCAATTTTGCTCCCATGACCGTAATGAGG
AGCAGGCTAAATGTGTGCCACTGGAACCACAACACTGACAGCGCTTTATTTCCCATTTGC
TATCAGGTGCATTATAGTCTCGCCCTTCTTTGCAACGA


invisible?    
Gene introns: 0  

>19362 133 375     8q21.13    chr8:82271245-82271113 BLAT!
TGATAATATACATTTTTTTGAAAATATACTTCCCAAAACAAAAGGATTAAGGTTAAAAAT
AGCATTGTTTTTGACAATCTCTATAATATCTTACAAGAAGACAACTGATTCTTGTATTTG
CTTCTGCATTCAA


invisible?    
Gene introns: 0  

>8786 124 374     3p24.1    chr3:28006049-28006172 BLAT!
TTCTGTGGCATGTCACTTATCTTTCTGTTGATAAACCAGAAAGTCTGACTCCTCTGCAGA
GCCCATTCTACTTACAGACCACAGGCAGATTGAGATGGGTATCATTTTTCCATTTACTAA
AGAT


invisible?    
Gene introns: 0  

>12432 118 374     2q31.1    chr2:170983694-170983811 BLAT!
AGAATAACCAGTTTAGAGAAGAACATAAATGACCTGATGAAGCTTGAAAAACACAGCACA
AGAACTTTGTGAAGGATACACAAGTATCAATAGCTGAATCGGTCAAGCAGAAGGAAGG


invisible?    
Gene introns: 0  

>17587 158 374     17q24.3    chr17:69309986-69309829 BLAT!
TCCTATTCAATACATTTCTCCTTCACTGAAAATTCTTGAATCTTTCATAAGCATGTTAAC
TCTTTCACAGTGCCATGTAGGAAATTCTTTCTCTACAAAATTAAATGGTATTCAATAGCA
AAACTCTGATTTTTTTTTCTCCTTCCAGTTTGAGGCTT


invisible?    
Gene introns: 0  

>90 125 373     4_gl000194_random0    chr4_gl000194_random:163197-163321 BLAT!
GGAGAGATTTACAAGAAAGTATTAAATTTGATCCATAGGAAAGCAAAATCAAAAATCAAT
GAATTTTCCATTTGTAGTTTTCCCTAGGGGCTCTAATCTCAAGATGGCTTAAATGCATTA
GAATT


invisible?    
Gene introns: 0  

>8794 136 373     7p12.3    chr7:45913403-45913538 BLAT!
CTAGTAACGACTAGAATGATCTGTGGTAGTTTGTTCTTAGACATAATCTCAGTTTTCTAA
CAACCCCAAAGCAAAGTTTTTAGTGTGCCTATTTTATTTTATTATTCATTTACTTACTTT
TTTTTTTTTTTTTTTT


invisible?    
Gene introns: 0  

>10471 132 373     6q15    chr6:91877915-91878046 BLAT!
GTTTGGTGGCCCTGTGCCAACCTTTCAGTAAATCTAAGGGACTCAGCTAAAGACAGAGAA
ACTATATCATTATGATAGACACTTTATTTATTTTTAATAGACCAACAAGGCAATATAGCA
TCCTTATGGAGA


invisible?    
Gene introns: 0  

>4174 157 372     3q21.2    chr3:125154989-125154833 BLAT!
ATTAGATACAATAATGACAATAAATGCATGTCAAGTGTGCCTGGTAGGTATGTGCTAGGT
AAATAACGTTGGCTATTGTTCAATGGAGTAAGGGATCTGGGACATCTCACAGAATCATGG
AATGTTATTGCTGGTGGTCCCATAAGATCATAGGCTA


invisible?    
Gene introns: 0  

>4851 126 371     2p16.3    chr2:49060526-49060651 BLAT!
ATTGTCCTGGAAAGTTTTCTTGGTATTTTCTTGTGGTAGTTTCAGAGTTTGGGGTCTTAG
ATTTAAGCCTGTAATTCATTTGGATTTGATTTTTGCATATGGGAAAGATACGGGTCTAGT
TTCATT


invisible?    
Gene introns: 0  

>5221 165 371     15q26.3    chr15:101810900-101811064 BLAT!
AGCGTTGTGGACCAGTTACTAAGCCCATCTAAGCTTCAGTTTCTGAAAACCAAGGTTAGT
AACATACCCGTTTCATAGGATTCTAGGGGGATCAAACAGAAATGGACACTCCTGCCACGT
GGTAAGTGCTCTTCAAATGCTATTACACAACGCAAGTTTCCCCTC


invisible?    
Gene introns: 0  

>20252 179 371     8q24.21    chr8:129842120-129842298 BLAT!
ATAGACTTTCTAACGCACATCTACATAGAACACATTTCTCTTCTGACTTGTTCATCCAAT
TTGCTCTGTTCCTTTATTTTAGTAGCTAATGACCAGTTGTAAGTATGTAGGTATACTCGT
TAGGTCTTCCAGATAACACAGACCTAACTTATTTGTCAAATGATAAAAAGAGGAATAAA


invisible?    
Gene introns: 0  

>3372 192 370     2p24.3    chr2:15146603-15146794 BLAT!
ATAACTGAAAAAATATTAATTGTATACACAATATGATTACAACTATGCTTTAAAAATGAA
ATCTATGCTAGCGTAAAATATGAAGGATTCCCATGAAAAGGTCAAAGGTGATTTCTGTTT
GGTGATAAGACTAAAGTCAATACTTTATTCTTCTTTCTGTGGTCCTATATAAAAATAAGC
TTTATTTAATAC


invisible?    
Gene introns: 0  

>7547 122 370     12q23.1    chr12:98348946-98349067 BLAT!
GAGTGAGGCGTAGCCGCACAGCAGGAATGGATCCATGGTTGAAAGGTAAAATCTGTCATG
AGGCTGTCTCACCAGCAAATAGGGGATAAGGCAACAGAAACCCTTCTTTGCTGCTAAGGT
GG


invisible?    
Gene introns: 0  

>6354 163 369     9q21.13    chr9:75176668-75176830 BLAT!
ATTCCACAATTCTGCCTCAACTGCTTCTCTACATTTTAGGCACACGTTTGAATACTGAAA
ATTTGGGTCACAGAGTTGGAGATGTTTCTTCTTCTAGGCCCCAAACCGGAGCGGGGTGCA
GTGGCTCAAGCCTGTAATCCGCACTACTTGGGAAGCTGAGGCG


invisible?    
Gene introns: TMC1 (75136716 - 75451267)  

>13347 145 369     18q22.1    chr18:62087318-62087462 BLAT!
AGGCCTGAACCACTGTGCCTGGCTGGTATGTTGTTTTCAAAGTTAGGAACAAATGCTAGG
TGGGAGTATAGTCCAACTGAATTTAATATATATAGACGTGCTCTAGAATTGATGGTCACT
CTGGTCTTCTTGCATTGGTATCCGG


invisible?    
Gene introns: LOC284294 (61771324 - 62090827)  

Shown 1111-1140 from 1945 sequences on 38 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs