Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1141-1170 from 1945 sequences on 39 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>17828 169 369     13q13.3    chr13:38997533-38997365 BLAT!
TCTTTGATATGGCAAATTATGTGGAAAACATTGTCAAATAAGAAATGATGTTTAACCTTT
TTCGAGTTATATTTTAATTAATGTTATTAATATCTGTTCCAAAATTGTATAGAATTCCTA
AAATTCTCAAATGTTTGGATCTATGCTATCATTCATATTTTTTGCTGTT


invisible?    
Gene introns: 0  

>8841 156 368     Xp11.23    chrX:47372180-47372025 BLAT!
TGTCCTGATCCTGATTTAGTATTGAAGTTCGGTCCTGTGGACAGCACATTAGGCTTTCTT
CCCTGGCACATCAGATTGACTGAGATTGTCTCTTTGCCTTCCCACCTAAACATCAGTTAT
GAGGACTTTTTCTCTGCCCTTCGTCAATATGCAGCC


invisible?    
Gene introns: 0  

>9663 149 368     17p11.2    chr17:18553983-18554131 BLAT!
TGTGTTACAACAGATGATGCTTTGCAAGAACTTGTGGAACTCATCTATCAACAGGCCACA
TCTATCCCAAATTTCTCTTATATGGGAGCTCGCCTGTGTAATTACCTGTCCCATCATCTG
ACAATTAGCCCACAGAGTGGCAACTTCCG


invisible?    
Gene introns: 0  

>14703 151 368     6q16.1    chr6:95972404-95972254 BLAT!
TAATCAGAAGACTTCAAAAGCAATGTAGAAATTTACATGGATTACAAACCTTAATCCTTC
AAAAGCTAAGTTTTCCTAAGTAACCCAAAACCCAAGAAAGACAATGTAGCAATTACCTTG
ATAAAATTTATTATCTTTCTTTAAGTTAGTT


invisible?    
Gene introns: 0  

>18957 153 368     14q31.3    chr14:85441599-85441751 BLAT!
CCAATCACATCTTCTTGGTTGCTCTCTTTCTCTCTTTTTTCAACTCCTGTTTAGGTATTC
AAAATATTTCTACTCATTCCCAAATTAATGTTGGTTTCAATAGGACTTGATAAATTCACT
TGGAATAAATGTTACAGGCTGCTTCTTTCAAAA


invisible?    
Gene introns: 0  

>3362 131 366     20p12.3    chr20:6194643-6194522 BLAT!
TGTAAGTCTTCATGACTCCACATAAAAAGGCACTTTTGTTCTGAACATGAGAGAGATCAC
TGTCTTTAAACTGTTGAAGAACTGCCAATGCACCGTCTTCATTGAATTCTTTTAAAGCTT
CAATAGCTCTT


invisible?    
Gene introns: 0  

>4036 138 366     8p21.2    chr8:26578671-26578808 BLAT!
ATAACAGAGAATTTCTGGGAAGGAAGACTTACAGGGAATGACCCAAAGTGATGATGGGCT
TGGGTATCACATCTTCTTACAGGGAAAGTAAGCATTTTTACTCATTAGAAATGTTGTATG
TTCATTACAAAAATTTAA


invisible?    
Gene introns: 0  

>13018 100 366     13q31.3    chr13:91485690-91485591 BLAT!
ACAGTATGCTCTCAGAAATTTCTTTATTTGAACCCTATACCAATATCTGTTGATCAATGA
CCATTTTTGCTCAGCATGGAGAAACAGTGCCCTGCATGAA


invisible?    
Gene introns: 0  

>15874 156 366     5q11.2    chr5:52494387-52494232 BLAT!
AGAATAAATCTCTTAAAATATCTTACAGAGTTTGACTCTTTTCATCGACAACTTCAACTG
TGGACTTCACATGTCTGTTTTTAGTCCCAGTGCCTTTGATATTCAAGAAGAAATTGTCCT
CAACAGGATAAAGTGTATTTCCTTAAAATATACAGT


invisible?    
Gene introns: 0  

>17283 165 366     6q24.2    chr6:144438262-144438426 BLAT!
TAGCTGAGGGCAAAAGTATTTTTCCTTCTTTGGTGGCTAGCCATCCTGAGGGGAGAAAAC
TATGTCCTCGTGGGGTTCCCCATTCTATTTCTCCTGTTGCATACTGGGGTTTGGTTTCCC
AGAGGGGATTACCCCATACTAGGGGTCCTTCTATAAGCAGTTCTA


invisible?    
Gene introns: 0  

>7496 138 365     5p14.2    chr5:23889923-23889797 BLAT!
TTTAATTCTGTAAGACAAATCCACACATCACAAAGCAGATTCACAGATAGCTTCTTTCTA
GTTTTATCTGGGTTTATTCAGTTGTTCCCTTTTAGCTTCAATGAGCTTCCAAATTTCCCT
TTGTAGATTCTAGAAAAA


invisible?    
Gene introns: 0  

>17150 185 365     6q15    chr6:90431334-90431150 BLAT!
TAAGCTGCATGCTTGCTTGTTGTGGTCATTAAAAACCCTAGTTTAGGATAACAGGTCTGC
CTGCATTTCTTCAATCATGAATTCTGAGTCCTTTGCTTCTTTAAAACTTGCTCCACACAG
TGTAGTCAAGCCGACTCTCCATACCTTTAAAAGGTATGACAGGAACTGTCTTCATGTCCT
TACCC


invisible?    
Gene introns: MDN1 (90353230 - 90529442)  

>18349 140 365     Xp22.13    chrX:17404330-17404191 BLAT!
CCAGACCCTTAAAAGATGTTCTAGAAAAGCAGTTATAGGTAGATTCCGTATGACATGAGA
CACCAGAACAAAGATGAAAAGGCTTGCATTACAAAAAGACAGATTCACTCTCAATGTAGA
TAAGGACTGTTTGAGAATGG


invisible?    
Gene introns: NHS (17393542 - 17754113)  

>18444 151 365     12q21.2    chr12:79010423-79010273 BLAT!
GTCTGAGTAAATTCAATCAGAAACAAAACTGATTTTACAGATATTAGGGATCAATAGTTT
TAAAAATTACTTGTAAACCTAGGATAAACACAAGTGACAGAATTGTCAAGATTATATAAA
CAAGAGATTAGTTATAAGTTATTTAAGTGCT


invisible?    
Gene introns: 0  

>15472 189 364     6q22.32    chr6:127008618-127008430 BLAT!
GAAGAGCTACTCCTGCTCACTTTTGGTTTCCATTTGCATGGAATATCTTTTCCCACTCCT
TTACCTTAAGTTGATGTGAGTCCTTATGTATTAGGTGAGTCTCTTGAATACAGCAGATAC
TTGGTTGGTGGATTTTTATCGATCCTGCCATTCTGTATCTTTTAAGTGGAACATTTAGGC
CATTTACGT


invisible?    
Gene introns: 0  

>16821 156 364     3p12.1    chr3:86295658-86295577 BLAT!
GAGCTGTCTCTCCAAGCAGAAGAAGAAGAAGACAAAGAAGCCGAAGGAGCCACAGCCGGA
ACAGCCACAGCCAAGTACACACACACCATTCAGCATTAGTTAAGTATCAATTTGTTTCCA
CATTATTGAAAAGAGACATCACTTTCAAATTGACTT


invisible?    
Gene introns: 0  

>17159 156 364     10p11.21    chr10:36290767-36290922 BLAT!
GACTGAGTAAAGCTGGTTACCTTCCATAATGTGAATGGGCCTCACCCAATCAATTGAAGA
CTTTACGAGAGAAAGCTGAGGTCCCTCAAAGAGGAAGGAATTCTGCCTCCAGATTGCTTT
CCTTTGGGCTTGAGTTGCAACATTAACTTTTTCCTT


invisible?    
Gene introns: 0  

>6138 134 363     10q26.11    chr10:119480442-119480309 BLAT!
TTTGGAATTTAGAATGTGGTCCTTCCTTTTTTCCAAAATAATGATGTTCTAAAATGATGC
ACTCACAGTGACCAGGGCACAGACTAGCCCAGTAAGTCCTATTTTGCCTGTGACATAACT
GCAACAGCATTCAA


invisible?    
Gene introns: 0  

>3349 146 362     16p13.3    chr16:3934021-3934153 BLAT!
ACCTGTAGTCCCAGCTGCCTGGGAGACCAAGGCAATAGGATCACTGGAGCTCAGGAGGTT
GAGGCTGCAGTGAGCTATGATCAAACCACTGCACTCCAGTCTGGGCAACAGTGAGATACT
GTCTAAAAAAAAAAAAAAAAAAAAAA


invisible?    
Gene introns: 0  

>15288 122 362     6q12    chr6:68383805-68383926 BLAT!
GAGGTTAAAATTTTGACTGGTAAAAAAATATTTTACCCATTTGCTGGCACGTCATGCTTC
CCCCAAGCTCAATTCTAAGCAAACTAGTTTAAGGTTTCAGATATTAACTTTTCTCAGTTT
GA


invisible?    
Gene introns: 0  

>16423 150 362     4q25    chr4:113377763-113377614 BLAT!
TGAAACTGGTTTCTGAGGTTCATTAGGATCTTTCTTTTTTCTCTTCTTTGGGGCCTTCTG
CTTTTTCCCTGCTTCCACCACGACTGTCTTCTGGCTGGGAAGTTGCCTCCGGAAATCCTC
AACACAATCCTCGTGAAGTGAACTAGTAGG


invisible?    
Gene introns: 0  

>20019 127 362     14q22.2    chr14:54676414-54676540 BLAT!
GTGGAGCAGCTGTGAAAGGGAGATATGCAAGGATGCATAGCCAAATATTAATCCAGGGAC
CTGCATATGCAAACTTCTGAAAAATCCAAGGCAAAGGGTTGTATGAAACCCACAGGAATA
GGAGGAA


invisible?    
Gene introns: 0  

>7742 161 360     18q23    chr18:75312156-75312316 BLAT!
ACTGCTATAAAGAACTGCACAAGACTGGGAGATTTGTAAAGAAAGGAAGTTTAATTGACT
CACAGTTCCGTATGGCCGGGGAGGCCTCAGGAAACTTACAATCACGGCGGAAGTCATCTC
TTCACAGGGCAGCAGAAGAGAGAATGAGTGCCAGCAAGGAA


invisible?    
Gene introns: 0  

>10793 144 360     3p25.3    chr3:10890146-10890003 BLAT!
GAAAATCCCACATGCCTAGCATCAAAAGGTTGTGAGGCATACTGGGAGGTGCCCAAGGGG
GTTTGTGGAGAAGAACATGTATGAATGTTGTCCCAGCAAGGAGATGCTAATGCCAGCGCT
TCCTGGACTTCACCTCTGGTGTTC


invisible?    
Gene introns: SLC6A11 (10857916 - 10980146)  

>18312 123 360     13q22.2    chr13:76608815-76608937 BLAT!
ACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGATAAAACCCTGTCTCTACTAA
AAATAAAAAATTAGCTGGATGTGGTGGTAGGTGCCTGTAATCACAGCTACTGGGAGGCTG
AGG


invisible?    
Gene introns: 0  

>18652 144 360     14q12    chr14:25165718-25165575 BLAT!
TCACTCCTCCACTCACTCACCTTCCACTCACTCACTCCTCTGCTCACTCACTCCCCCACT
CACTTCTCCACTCACTCACTCCTCCACTCACTCTTCCACTCACTCACTCCTCCACTCACT
CACTCCCCCACTCACTCACTCCCC


invisible?    
Gene introns: 0  

>4665 179 359     1p11.2    chr1:120762612-120762790 BLAT!
ATCTCATCAATTTACCAAGTCCCAAAAAGAGTAGGTTCCAGGTCTCTAGTAAGGCTTCGA
TGCCAGGTTTTGTATATTCTCCCTTATAATCAACTTTCCCCTCAATTCTTAGAAAGATCT
TATGGAGTTCAGAAGACGATAAAGATGGAAAGTTGTAAGTCCTGAGAGATATAATTGAT


invisible?    
Gene introns: 0  

>17594 133 359     4q32.1    chr4:160311587-160311719 BLAT!
CTTGGAGAACTTTTATGTCTAGCTGGAGGATTGTAAATGCACCAATTAGCACTCTGTGTC
TAGCTAAAGGTTTGTAAATGCACCAATCAGTGATCTGTGTCTAGCTAATCTGGTGGGGTC
TTGGAGAACTTTT


invisible?    
Gene introns: 0  

>3271 180 358     Un_gl0002200    chrUn_gl000220:16373-16552 BLAT!
GGAAATGAGTCTATTCTTAACCTAGAGGTGTGAATGATGCCAATGCGCCAAACCAGGCAC
AACGGAGAAGCTGACGAAGTCCCTGACAGCAGCCTTCCAGGGTCAAACTCTCTTCTTTTT
ATCATTTTTCTCAAGTTTTACCAGGACTTCCTCACCACTCTGTAGTTCCTGGACCAGCTG


invisible?    
Gene introns: 0  

>9491 164 358     12p11.22    chr12:28100357-28100194 BLAT!
CTTGTTTATATCCTGATGGACTGTAAGCTTCATGAGAACTGTATCTTTTATTCCACCACC
AGCACATGGCATACCCTGGCCAGTATCAAATGCTCAACAAGAATTTGTCGAACGGGTATG
AATTGTTGCCTCTAGATTTTAAGCTTCCTAAAGGCCAGGGACTT


invisible?    
Gene introns: 0  

Shown 1141-1170 from 1945 sequences on 39 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs