Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1171-1200 from 1945 sequences on 40 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11442 155 358     9p21.3    chr9:21879923-21879769 BLAT!
AGGAGCCCCATCAGGTTAACAGTGGACCTCTCAGATGAAATCCTACAAGCCAGAAGGGAT
TGGGGGCCTATATTCAACATTCATGAAGAAAAAAAATCTTCCACTGAGAATTTCATATCC
AGCCGAACTAAGCTTCCTAAGCAAAGGAGAAATAA


invisible?    
Gene introns: 0  

>21763 171 357     16q22.2    chr16:72264167-72263997 BLAT!
TTTGTGTATGAACACTATGGGATCTTATGAAAAGGGAAGACAATCAGAGAGGTCAGTTTA
AATATTTCCTAAACTTGGAACTCTATTATCCTAGTGCCTAGCTCTCCTCCTTACCAGTCA
GTAAAAGCACACAAATGAATGTGTTAGGATTCTACGTGTGTTGGCCCATTT


invisible?    
Gene introns: 0  

>3961 206 356     1q32.1    chr1:200601370-200601165 BLAT!
GTCTCGAACTCCTCACCTCAAGTGATCCACCTGCCTAGGCCTCCTAAAGTCCTGGGATTA
CAGGCGTGAGCCACCGCGCCTGGCCAAAAATTGAATACTGGATTGATTGATTTTTTTCCC
CTAAAATATTAGGAAGATAATAGTTATGGACACTTGATCTAGGTTTTCTCATTCTCTTTG
TTGATATATAATTCAGAAATTTATAA


invisible?    
Gene introns: 0  

>19512 103 356     5p15.33    chr5:2788009-2787907 BLAT!
AAGAAAATATTGCATCTGTCTTAGAAAATTACCATACAGAGTCTAAGATTGATCGAGACA
AGTCTTTTATACTTGAGGAACACATGGACAAAATAAACAGTTG


invisible?    
Gene introns: 0  

>6265 115 355     13q31.3    chr13:91486669-91486783 BLAT!
CAAAATTGTTTTTAGAAATATATATAAAACAATTAGCAAGTTGGATTTCTACAGACTAAG
CCAAGAAAATGCAATTCTGTTGAATTGGGTGCAAAATAATTTTCATTTTAGATAA


invisible?    
Gene introns: 0  

>6564 134 354     2q22.1    chr2:140093920-140093787 BLAT!
ACGTTTATTATATATACCTGTAGGCTTTTGAGTCTCTGTATCTCAATTTATACTACAAAG
GGATAATCAGTAACATCGTAATATATATTTTAATTATCATTTCATTGCATTCATGTTTTG
AAAGATCATTGTTT


invisible?    
Gene introns: 0  

>22904 161 354     2p24.1    chr2:20331491-20331331 BLAT!
TTCCTTCTTTACCCAGCTTAGAGAGGTTCCCTCTAGAGTCAGTTCCTGAGACTTCTAAGC
ATCCTGCTTGTAAATGGTTTTGATTCTAAACTCTCCCCACTGCTGGCCTAGGAACTGGCT
TTCTCCATCTGCGTCGGAGAATGCTCATCTGCCGGCTTCCC


invisible?    
Gene introns: 0  

>9633 185 353     21q21.3    chr21:29067126-29067310 BLAT!
AGCTCCTTTGAGTCTTGATGGTAGAGTCACATAATCTCAGGTCTGCACGGCATTCCCATT
TACGGTGTTTCTCCACCAGGGAAAATTGGTGAAACTCAAAGTTCCCAGGATGATGCTGGG
AAGAACTTAGAGATAAAACATGCACTGCCTAAGAGGAGTGGAATGTGAATGGAGATGAGG
CTGTA


invisible?    
Gene introns: 0  

>12152 162 353     2q22.3    chr2:147997237-147997076 BLAT!
AAGCACATATAATAATGAAAGGCATTAAGTTAGCAGTATTATGTTAAGTATATGAGAATT
AAACACCGCATGTAAATAAAACTGTTGAATTTTTGAAAACAAGAGCAACTCTATGCTATG
AATAAAAAATAATCTTTATATATAAAGATACCTCCACGTTAG


invisible?    
Gene introns: 0  

>20577 156 353     10q26.13    chr10:125994377-125994530 BLAT!
TATATCTACCTCTCAAGATTGCCAAGAATATGAATGAGCTACTGCATGTGTCATATATCA
TGCTTAGCTCTGTAATGTTACTTTATAACCATCATCGTCATCACCATCATCATCACCACC
ATCTTCATTATCATCACCATTATCACCACCACCACC


invisible?    
Gene introns: 0  

>21609 144 353     Xq25    chrX:125404832-125404689 BLAT!
TATACATTCTTCTCAGCACCGTGAGACACTTAACTCTAACATTTATCGTATAATTTGAAG
TAAAATACTCTTCAGCAAATGAAAAAGAACTGAAATAATACCAAGCAGTCTCTCAGACCG
CAACACAATCCAATTAGAATTCAA


invisible?    
Gene introns: 0  

>10728 188 352     8q24.21    chr8:130816654-130816841 BLAT!
CCGAGAACCATTATTTCTGGAGCAGTGCATAAGAGAAGGGAGAACCTGTATGTGGTAACA
GAGGCCACAGAACTGATCAGCACTCCTGTGCTAAAGGACAATAGCAGTATGATTGATTTC
AGCAAATGTCCATCCTTGGAATACTTATGTCAAGATACAGAGCCACTGACTGAGTGTTGT
GGCTCACA


invisible?    
Gene introns: 0  

>16577 155 351     9_gl000200_random0    chr9_gl000200_random:29070-29224 BLAT!
ACGTGGTGACAGAGAGGCAGATGTTTTACTGTTTCCACTTCTGGAACTTGTTGCAGGGTA
TGAAGAAGGTCAGCACCAGAGAAGATATAGAATATCATGTCTGCAATGGATGAAGCCATC
AAAGGATGGCTTCACTTCACCACCAGGCAGCACTG


invisible?    
Gene introns: 0  

>15831 178 349     6q22.33    chr6:128268678-128268501 BLAT!
AATGGCTATATACCATGTTCCCAAGTCCATGTTAATTTGTGCTAGTAAAGATAATATATC
TGAAATGCCAATTTTAATTGGAGTTGCTGCTTAATTGAGTTTGCAGTAACCACCGTTACC
AAGAGGATGTATCTGGTTTCTCTAGGTGCCAGATTGGTAAATGAAATGGAGATATGTT


invisible?    
Gene introns: 0  

>22455 140 349     2p22.3    chr2:35821219-35821358 BLAT!
TCCCTGCCAACCTGCCTATTCCAACTCTTTCCCACTTATTGCATAAACCCCTCATTCTCT
ATAGAGGGTATTTCACCCACTTCTCTACACAAAAATCTTTAGCTTTTTTCTCTCTGAATT
CTTTCTAGCTTCCTTCTCAT


invisible?    
Gene introns: 0  

>1015 123 348     4q32.1    chr4:160311583-160311704 BLAT!
GGGACTTGGAGAACTTTTATGTCTAGCTGGAGGATTGTAAATGCACCAATTAGCACTCTG
TGTCTAGCTAAAGGTTTGTAAATGCACCAATCAGTGATCTGTGTCTAGCTAATCTGGTGG
GGT


invisible?    
Gene introns: 0  

>18163 105 348     13q22.1    chr13:73610739-73610635 BLAT!
ATTCACTGGCACTCCAAGTTGCAACAAAAATTCAACAATTTCTGTATGTCCAGCTGAGCA
TGCCCAGTGCAATGCAGTTCTGCTGTCCTGGTCAGTTCTAGTAGC


invisible?    
Gene introns: 0  

>17167 142 347     Xq21.33    chrX:95326105-95326012 BLAT!
CACTGTTTGGCTTATTTTTGGTGTGCAATTATACCAATAGTACGCGGGGGATGAGGATGA
AGATCTTTCTAAATATAAGTTAGATGAGGATGAGGATGAAGATGACGCTGATCTCTCAAA
ATATAATCTTGATGCCAGTGAA


invisible?    
Gene introns: 0  

>21510 123 347     18q12.2    chr18:36007609-36007487 BLAT!
TTCATCTTCCCTTTCTACTTTATGTCTTCCTCCTTCCTTCCTTCCTGTAACACTCACACT
CATTTCTGCTTGCTAGAATTTCAAATGACTGTTCCAACTAGACAAAAAGAAATCCTGTTT
CTA


invisible?    
Gene introns: 0  

>606 117 346     11q24.2    chr11:125937713-125937592 BLAT!
GAACTTCCTCATAGAATTTGGCTTCTATCTGTGCACATTTAACTTGCAGGTTTTTGAGAG
CATTCACTCGTCTTTTAACTACCCTAGGCAGGCTTTCAATGTATCCTGTTGGTGTTT


invisible?    
Gene introns: 0  

>5648 105 346     2p22.3    chr2:36306475-36306579 BLAT!
TGTGTGTTAAGAGGCATCCCACGTGGTTTCTTGTTCATTTCATTTAGGGTGCCTTCACTG
CAGCTTCCTTCCATTTTCTGACTCCTTAAAGATGAATTCGTGTTT


invisible?    
Gene introns: 0  

>3813 154 344     1p13.1    chr1:116358959-116358806 BLAT!
TTGAAGAGTGCTTGGTGATTATGGTGATCATGAAATAAAAGTAAAAAGAGCTGGAGAGAG
CAGAAGGACAGCTTTCCCCATGAATAAAGGAAAATCGCAATATGACAAGCATCCTCATAT
CTCCCAGCCTCTCACCCCTGGCCCTCATGGAGCA


invisible?    
Gene introns: 0  

>14124 130 344     7q31.1    chr7:113250098-113250227 BLAT!
AAAATCTGGCAACCATGGGCAGTGGCCCCACGTGGGAACACACAGCTAGAACTAAATAGT
AGTATTCCCTTTTTGATGCTGCACAGATCCTCCAATTCTCCAATCTCCACTACTCCTTAT
TTTTCCCTTC


invisible?    
Gene introns: 0  

>15469 167 344     8p12    chr8:34530444-34530610 BLAT!
AGGATAAATTTCTGCCCAGTAACTTCACAACTTAGGTAAGAAACATTATTTTTGAAGGTT
GGTTTACTCATTCACTCAGTTTACTGGTTTGTCAACTATTATTTGCCAGCAATACACTTT
GTGCTAGGAATACAGAAGATAATAATTCCAAGAGGCATGATTCTTAA


invisible?    
Gene introns: 0  

>16557 137 344     17q12    chr17:36124508-36124372 BLAT!
ACTGCTTCCAACCTCCACAGTCTTCATAATTACTTCTGCACTACCTCCCAACCTTGTAAA
TTAACAATCTTATTTCCTAAAGCCTTCTACTTTATTTATCCCCAGTAATCACAGGTTAAT
CAGATAAACTACCCTGT


invisible?    
Gene introns: 0  

>2977 133 343     8q22.1    chr8:97009479-97009347 BLAT!
TAACTAGCTTCTGGGATTGGGGGAAAATATGCAGAGGTCATTTAGCCTTCCTATAGTCAT
GTCTGTATCCCAATGAATTCAATACTCATTTGCCCCATGCTTCTTCCTAATCTCAGCTTT
CTCCTCGGATGTG


invisible?    
Gene introns: 0  

>4647 169 343     Xp22.31    chrX:6893259-6893091 BLAT!
AATTGACAGAAATAGGCTTCAGAAAGTGGGTAATAACAAACTCCTCTGAGCTAAAGGAAC
ATGATCTAACCCAATGGAAGGAAGCTAAGAACCTTGAAAAAAGGTTAAAGGAATTGCTAA
CTAGAATAATCAGTTTAGAGAAGAACATAAATGACCTGATGGAGCTGAA


invisible?    
Gene introns: 0  

>7274 181 343     18q12.2    chr18:33562163-33562343 BLAT!
GATCTGCCCGAATCGGCCTCCTAAAGTCCTGGGATTATAGGCATGAGCCACACCGTGCCC
GGCCCCAACTTGAGATTTTTTTTAACATTATGATGGGTTTACCAGGACATAACCCATCCT
AAATTGAGAAGCATTTGTATCTGATGATAAGGGACCTACATCCAGAATTATGAAGAACTC
T


invisible?    
Gene introns: 0  

>18900 146 343     1p35.2    chr1:30391882-30391737 BLAT!
AAACATGGGCAGTGGTGGGGCCAAGATTGAGCCAGGAGAAGAAACAGAGATGGAGAAAGG
GGTGTGGATAAGTGGAGGAGGGAGACCCACCCCCAAGGGGGCCTAAACTGACACTCCCCC
TGGAATGCTCTCCGTCCAACCCTTCC


invisible?    
Gene introns: 0  

>13472 144 342     7q21.12    chr7:86734077-86734220 BLAT!
CTTTTGAAATTCTTCATGGGTCTGCAGCCATAGGTCCTGCTAAATTTTACACTTGATAAG
CTAACCAATTCTTGATTTTATTTCAAAATTCAGAGGAATAAGGAAACTGCTTCTTTCTTT
TCCAGGAAATTCATTTAAAAATTT


invisible?    
Gene introns: 0  

Shown 1171-1200 from 1945 sequences on 40 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs