Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1201-1230 from 1945 sequences on 41 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18403 113 342     3q13.31    chr3:115137450-115137338 BLAT!
GTGAGAAACAACTCTGTAGCCCAGATGCTTATAGAAAAATGTAGGGAAATATGAAATGGC
AATCATGACAATAATTGGATGTTGACATCATTTCAATGGGCAGTGATTCTATT


invisible?    
Gene introns: 0  

>21611 175 342     4q31.3    chr4:151888387-151888561 BLAT!
AACCCCTGAACAAAAATCATCATGGCTTCTCATCACCTACAGAATAAAATTTTAATCACT
TGGGCAACAACGCAAAATGTCAAAAAGTCTCACTTCCCATGTTGTCCCTATACAATCCAG
TCCAGACTATTTATTATATCCAGAAGGAGTTTTAATATTCTACTCCCTTGCCTTT


invisible?    
Gene introns: LRBA (151185595 - 151936649)  

>21969 166 342     3q22.3    chr3:137667162-137666997 BLAT!
GAGGCTGCTTGATTCCCTGTCCCATCTCTACTTCTCCACCAGCTATGCTTTCTACAAATG
CATGTGTCTCCTCTGGATGGGACACTGCTTCTCAGGCTTGTTGTTGGCCATCAGTGCCAG
GCTCAGAGTAGATGCAGCATTGACAAGGGGAATATGTGAGTCAGCA


invisible?    
Gene introns: 0  

>9085 163 341     11p14.1    chr11:27816458-27816620 BLAT!
GCTTCTGGGGAGGTCTCAGGTAGCTTTACTCATGGTGAAAGTTGAAGTGGAAGGGGGCAC
GTTGTAGAAGTTCATAGGTAAGGTCAATGCTGGAAACGAAAATTTGGTAATTATCAGCAT
GTGGATGGTATATAAAACCACGAGACTTGGAGTGACTTGGGGA


invisible?    
Gene introns: 0  

>13992 174 340     13q13.1    chr13:32359263-32359436 BLAT!
CAGGCTCCCTCCCAGAAAGTCTGATGTGATAGTTCCAAGGTGGGTCCCGGGGATGTGCTC
TTTTTATAAGCATCCTTGGGGACTTGGATGCTTGGACTCTACTATGAAAACTACTGCCTT
GAAGTGCACGCATGGCTTTCCTATTTTGTCTCCACGCACTCTCCATGACGTCCT


invisible?    
Gene introns: RXFP2 (32313678 - 32377009)  

>16365 100 340     Un_gl0002190    chrUn_gl000219:23175-23076 BLAT!
GAGTTGATTTTCAGAATCATAATAGAAACCAGTGCTGTGGTCAAAATACAGTCCAGTATT
TTCATCATAACTAAATCCAGTCTGTGATACAGCCGCTTCT


invisible?    
Gene introns: 0  

>10170 143 339     6p24.3    chr6:9987071-9987187 BLAT!
TAACTTTAATAAGCTTTTATGGAATCATGTACCCACACACTCACACTTTCTCACACACTA
ACATATACACTCACACAAGCACACACAGAGCTTACCTACTAGATTGAAATATCTTACCTA
CCACATTGAAATTGTGTTCCAGT


invisible?    
Gene introns: 0  

>14563 142 339     6q15    chr6:88432414-88432555 BLAT!
CTCTAACACCTTAACAGGCAAACCTCAGAGGAAGGTCTGCTTTCCTCTTCCTTTAGAAAT
CCCCCCTAAGCAAGAAACATTTGCTGAATGCCTAGCTGGGGACTTCAACATTGTTAGCAC
ATGTGAGCAGCCTTCCAAAACT


invisible?    
Gene introns: 0  

>14646 163 339     2q35    chr2:216007520-216007682 BLAT!
CAGCCTCCCATTTTGTATGTGCAACTACTACTGTATTACTTTGAAAGCATAAGGCTAGGG
GGTAAAGGAACTAGTCAATAATTTCAATTCAAATCAATAATCAAACATTTTAGTTGAGAA
GTCTCTTTCAAGCACTAACTGATCAGCAATATTTTTTTGTTTT


invisible?    
Gene introns: 0  

>5986 138 338     5q11.2    chr5:56940153-56940016 BLAT!
AAAACAACAACAAAAAAAACCCATTAAATATTGGGCAAAGGACATGAACAGACATTCTAC
AAAAGAAGACATACAAGTGGCCAAAAAACATGTCAAAGAATGCTCAACACCACTAATCAT
CGGATAAATGCAAATTAA


invisible?    
Gene introns: 0  

>6444 132 338     10p14    chr10:8655943-8656074 BLAT!
GATTCTGACTAACCAGGCTCAGGTTTTGGTTCTACTCATTTTTAGTTACTTTACTGAGAG
AAAATTATGAAACCAGATTCCTAAGTTGTAAAATCTGGGTAAAAATACCTATCTCCAATA
GATGTTATGGGG


invisible?    
Gene introns: 0  

>16967 130 338     3q21.2    chr3:125155372-125155501 BLAT!
GGCTCAGTAAAGGTAAGTAACTGACAAGTCATGGAACTTGTAAGAGGTGGAGCCAGGAGT
CCAACCAGGCCTGAATGTGACTTCAGAATCCCCTGATTTGCAGCCTAGAGCCTCAGTCTT
GGCTACTGTT


invisible?    
Gene introns: 0  

>20802 166 338     1q32.1    chr1:203590548-203590713 BLAT!
TTCAGTAAATACATTTAAAAGATTATAGCATCTTTGATTGTAGCTACTCATGCTATGAAA
GCATCTTTTCCTTCTACTAAACTATAAGCTTATTACCTCTGTATACCTCATCTGGGCCCA
GTAGATGTTGAAACAGTAGACATTCAATAAATGTATGCTAAATTGA


invisible?    
Gene introns: 0  

>11830 178 337     4q28.3    chr4:135282088-135281911 BLAT!
AATATGGAAGACAACTGAGAAAACTGTGGCATAGTTTAGTTTAGTAAAATAATCTATGCC
ATGATAAACAATGTTTCCTTTCATTTCTCAATAAATAATGTTATGATGCCTATTCTGAGC
TATAAATTGATTGGGGCAGAAAGTCAAAAATACATCCTTTTATTCAGAAATGTCTGTG


invisible?    
Gene introns: 0  

>13192 145 337     3q23    chr3:138720936-138720792 BLAT!
ATCATCATATAAATGGATAAAGAAAATGTGGTATATATACACAATGGAATACTATTCAGC
CTTAAAGAAGAAGGAGATTCTGTCATTTGTGACATTAAGAACCTGAAGGACATTGTGATA
AGTGAAATAAGCCAGGCCCAGAAGG


invisible?    
Gene introns: 0  

>12 120 336     10q21.3    chr10:68189343-68189224 BLAT!
TTGCATCCCAGGGATGAAGCCAACTTGATCGTGGTGGATAAGCTTTTTGATGTGCTGCTG
GATTCAGTTTGCCAGTATTTTATTGAGGATTTTTGCATTGATGTTCATCAGGGATATTGG


invisible?    
Gene introns: CTNNA3 (67679724 - 69455949)  

>8228 147 336     Xp21.1    chrX:35534033-35534180 BLAT!
AGTGCTGGGATTACAGGCGTGAGCCACTGCGCCCGGCCCTTTTTTTGTTTTTTAAGACAA
GGTCTCACTTTGTTGCCCAGGCTGGAGTGCAATGGCTCCATCATAGCTCACTGCAGTCTT
GACCTTCCAGGCTCAAGCGATCCTCCC


invisible?    
Gene introns: 0  

>21228 111 336     Xq21.2    chrX:85501982-85502092 BLAT!
GAAAAATCTACCAAGTAAATGAAAAACAAAATAAAAGCATGGGTTGCTTTTTAATTCCAG
ACAAAACAAATTTTAAACCAATGAAGATGAAAAAGACAAAGACAGGCATTA


invisible?    
Gene introns: DACH2 (85403454 - 86087605)  

>9260 157 335     Xq13.3    chrX:74872362-74872518 BLAT!
TAAAACTCCTGCAGCTCGGTGCCTGCCCTGGTTTTGTGCTTGAAACTCAGGACTCTGATG
CTGTAGGCACATGAGGGAATCTCTTGATCCACAGACTGCAGAAATCCGTGGGAAAAGCAT
AGTATCCCAGGCAGGTAGCACAGTCCCTCACCACTTC


invisible?    
Gene introns: 0  

>16765 152 335     7p12.3    chr7:47667140-47667291 BLAT!
TGGTCCAGGTCCTTCTGCTCACCGCATGGAAAGCTCATCACTGAGATGACAAGTATTGCC
AAGGAAGGATTTAATCAGGTGCTGCAACCGAGGAGATGGGAGCTCAGTCTCAAATCCATC
TTGCTGACCTACTAAAACGAGGGATTTGTATA


invisible?    
Gene introns: 0  

>11624 115 334     1p22.3    chr1:86665917-86665803 BLAT!
GAGCCTCGGTTTTCTTATATATAAAATGTGAAACCCAGCATTTAGATTGGAAAGAGATTT
TTGAAATTATGTGGCCCAAACTTTTTATTTCACTTATGCTTGTTAGCTCTGACAA


invisible?    
Gene introns: 0  

>22246 168 334     3q13.13    chr3:110232782-110232949 BLAT!
AAAGGAAAAGCAATAATAATTTAATTTTTATAATAGCAATGAGAACACAAGCTTAAAAAT
AGGTTATTTTATGTGCTAAGATTGAATAATCACACTAAATATAAAATAGAAATAAAAATG
TAAATAGAATTCCTCCTAATAGAAAAGCTATAAATTATGAATTTGATT


invisible?    
Gene introns: 0  

>11585 139 333     6p22.3    chr6:21649417-21649293 BLAT!
GAGGTACGCGGGGCCCAGCTACTTGGGAGGCTGAGGCAGAAGAATTGCTTGAACCCGGGA
GGCGGAGATTGCAGCGAGAGAAGATCGTGCCATTGTGCTCCAGCCTGGGTGACAAGAGTG
AGACTCGGTCTCAAAAAAA


invisible?    
Gene introns: 0  

>11953 106 333     4q32.1    chr4:156771027-156770957 BLAT!
TCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACATCAGTAGGCAGGTATGAAAA
GTGGCTTATGTATGTAAATAGGCTGCAGTTACTTTCTTCTAAAGTT


invisible?    
Gene introns: ACCN5 (156750880 - 156787425)  

>12542 155 333     4q31.23    chr4:150897872-150898026 BLAT!
AGAAAACAAAAAGAAATATGAAGGAGCCAAATCAGGATGGGAAAGCAGATGCCTAATGAT
GTCCCATCAAAACGCTTGCAAAATTGCCCTTGTCTGATGAGAAGAATGAGCAGAAGCATT
GTTGTGGTGGAGAAAGACTCTCTGGTGAAGCTTTC


invisible?    
Gene introns: 0  

>13128 156 333     Un_gl0002160    chrUn_gl000216:136527-136653 BLAT!
GCAGAGCGTAGAAAAGAGTTCCCTCCCCAGGGTGATCAGTGCAGAGATGTGTCACAAAGC
CCCCTTTAGGCAAAGCCAAGACAATAGTTACATCAATTGAGTGATCAGTGGCGATATCTC
TCACAATTCCCCTATAGGCAGAGCTTATACAACAGT


invisible?    
Gene introns: 0  

>19658 171 333     6q24.2    chr6:144437573-144437743 BLAT!
TCCCTCCCCCTGTGCTCTCAGGTGATAGATGATTGGCCATTTCTTTACCTCCTGTTTTAC
CCTAATTAGCATTTTAGTGAGCTCTCTTTACTACCTGATTGGTCAGGTGTGAGCTAAGTT
GCAAGCCCCGTGTTTAAAGGTGGATGTGGTCACCTTCCCAGCTAGGCTTAG


invisible?    
Gene introns: 0  

>7490 146 332     19p13.12    chr19:15895138-15894993 BLAT!
ACAGTGTCTCACTCTGTCACCCAGGCTGGAATGCAGTGGTGAAATCTCGGCTCACAGCAC
CTCTGCCTTATGGGTTCAAGCGATTCTCCAGCCTCAGCCTCCTGAGTAGCTGGGACCACA
GGCACATGCCACCATGCCTGGCTAGT


invisible?    
Gene introns: 0  

>8425 147 332     3p26.3    chr3:1550911-1550765 BLAT!
CCCTTTCCCATATCATGCTAATAATTTTGACTTATCTGAAAATTGCCCGTAGATAGCACT
ACTTCTGTTCATGTATACTATTATTTTCTGCTGAAGAGGGAGAGAAGGGTTCATGAATGA
GACTTACCTGGATTTTTTTTTTTAATT


invisible?    
Gene introns: 0  

>9618 110 332     5q13.2    chr5:70873852-70873961 BLAT!
AAACTCGCTTCTGTGCCTGCCCAGAAGGTTTGCTGAGGGCCATCGCTCCCTGGCCCCGGC
TCCTTGAGGTTATCTACTGGGACATCTAGAGCCTATTGTTCGAGGAATGC


invisible?    
Gene introns: 0  

Shown 1201-1230 from 1945 sequences on 41 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs