Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1231-1260 from 1945 sequences on 42 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>22760 136 332     6p22.3    chr6:23227895-23228030 BLAT!
TTTAAGCTATCTATTTCCTTGAATATTTCTACCTTCACTTCTTGCATCGTTTTTTGGATT
CCTTGCATTGGGCTTTGCCTTTCTCTGGTGCCTCTCTGATTAGCTTAATAACTAACCTCC
TGAATTCTTTCTCAGG


invisible?    
Gene introns: 0  

>8028 118 331     15q25.2    chr15:83385554-83385671 BLAT!
AGCCCCAGTCTCCCCTAGCACTCCCAGGCTTATTAGGACGAGGAAATTCCCACCTAATAA
ATTTTTGGTCAGACTGGTGGTCTGCTCTCAAACCCTGTCTCCTGATAAGATGTTATCA


invisible?    
Gene introns: 0  

>3508 176 330     12p13.33    chr12:2624970-2624795 BLAT!
CGCTTTCTTTCTGTTGTCCTTCCAGCCCATTTTTTCTACTCCTTGGTGGCTTTTGCAGCT
TTCCCTAAGGAAACAGAATCCCTGGGCTCCCCTAAGATATGCTGGGTGTCACCAAGCAGC
TCCTGCACTGCACTCAGCCCCACCTCCCCAGCCTCACACCACGGGCATCCAGATGC


invisible?    
Gene introns: CACNA1C (2162415 - 2807115)  

>6445 165 330     8p23.1    chr8:12698513-12698349 BLAT!
GTAGCAGGAATAGAAAAGTTAGGGATGAGAAGATAGGGAGTCTACAGTCAGACTTAAAGA
GGTTGCAGTTCTGAGATACTTTCCAATGCAATGTCCAACAGGCAGCAGGAAATACCAAAC
TCATTTGCCTGAAAGAGGAAGGCACTCAGAGAACACCAGGGGGCA


invisible?    
Gene introns: 0  

>5886 106 329     19q13.2    chr19:40488448-40488553 BLAT!
ACAACAAATAATACATAATGTATTATTCTATTTACATAAAGTTTTAGAAAATCCAAACTA
ATCTAAGTAACAAAGCATACCAATGGTATATGGGGCTTGGGGCAGG


invisible?    
Gene introns: 0  

>16754 158 329     4q23    chr4:101015786-101015629 BLAT!
ATCAAGTGTTTCTCTTCAGCAGCAATTCATCAGATAATTGCTCACTTTATTTAGTTGATG
TGGACACAGCCAATCTATGTCATTCTGGTCAAAATAATACATTTGCCCTAACATTAGTGT
TTTTTGTTTGTTTGTTTGTTTTTACTCTGAATTAAGCA


invisible?    
Gene introns: 0  

>10259 140 327     10q25.3    chr10:118419202-118419063 BLAT!
CACACATGCTCAGTAAATATTGTTATATAAATTACATTTACCATTCGGGTAAAAGGACCT
GGAAAAATTGCTGTAGCTGACATGCACTGAGAGTATTAGGAGTGACGTCTCGGAGCCCAC
ATAGTGAGTTATTGGCAGAA


invisible?    
Gene introns: 0  

>11101 162 327     11q21    chr11:95451166-95451005 BLAT!
AATTTAAAAGTCAGTATTTCTTTATATAGTATCAACTGTAGCCAGTTCCCATTTTTTCTA
CAAAATCTTCCCTGGGTGAATAGAAGGTAGATGGCCACTCTCTCTGATCTAATGGTTTCC
CATTTCTTTTTTTTGGCACAAAGTTATGAACAATAAAATTCC


invisible?    
Gene introns: 0  

>13159 135 327     10q11.23    chr10:52390175-52390040 BLAT!
CTGGCATATTGCTATGAAACCCGTGTCACTGAAGGAGAGAAGAATGTTGAATTTGCATGG
AATATCAGGAAACTGAGTCCAACACTATGCTGGTTTGAGACTTGGACTAACGTTCATGAT
ATCATGGTGTCTTTT


invisible?    
Gene introns: 0  

>17390 157 327     2q32.2    chr2:189879351-189879507 BLAT!
GGCTTTGCCAGGTTGCTTTTAGGGTATGATTTTGAAGATGGCTCTGAATGTCAGCATTCA
CTTCATTTTTTGTTGATTTTATGCACCTGGATTCTATAGCTTTCTCTGAATTCCTCTGAA
TTTCAGATAAAAATCCATAAATTACATTTTTACTTCA


invisible?    
Gene introns: 0  

>17938 115 327     4q31.23    chr4:148638582-148638468 BLAT!
TGCCCCTTTGCGAAGTTCTGAATATATATTATGGGGTGAGGTAGTAGGAGTAATGACAAT
TTCTCTTTATTGATTTACCTCTCCCATCCCTAAATATAATTAGAGAATGCATGGT


invisible?    
Gene introns: 0  

>10275 152 326     1q32.1    chr1:198727351-198727502 BLAT!
AAAGAAAGAGATGAAATAGTGGCTCAGAAAGCCCACTACTTTGTGAGAACATATACTAAA
CCGAAGGTGAGACCCATGGCACTAGAACATGGAATTATATGTCTATGATTTTTACCTGTA
GAAAGAAATAATATGTGAATTATAGGTCTATG


invisible?    
Gene introns: 0  

>22501 155 326     5q21.3    chr5:107062538-107062384 BLAT!
TGATCTTTATCAAACTTGGGTAAGGTCGCTCCACTAGCAGCCAGCTCGGGATCAACTGTT
TCCAGGAATATTGTCCAAGGGTTTTCATTATCACTGAGCTCAATCATTGTTTTATTGCCG
TCGGCTTCATTATCTAACATTGCTGGTCGTTTTTT


invisible?    
Gene introns: 0  

>18448 150 325     18q22.3    chr18:71479959-71480108 BLAT!
CCAGGATGGTCTCCATCTCTTTAAAAGTGAATGAGGAACTTCCTTGAGAGGAGACGCTGC
ACTGATTTTATGGAGACTCAACTTCTGACCACTGGGATGGGCCATTCCCTTCTAGCTGGG
GCTGTTTTAACTGCTCCCTTCGAGGGCAGG


invisible?    
Gene introns: 0  

>22537 160 325     11q12.1    chr11:56157831-56157672 BLAT!
GGTATGTAGGAGTATGATGATTAATTTATTATGTAGAAATAAAAACTCTCCATCTGTCTA
TATTTTTAGGAAGTCACAGAAGACAGTTTCATTGCTTGGGCAATAAGGAATGCACTAGCG
TAGAGGAAACTGGTATTTTTTTAGAGGCTCAATAGTGGCT


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>4649 140 324     4q13.3    chr4:72586874-72586735 BLAT!
AGGTCACCTACAAAGGGAAACCCATCAGACTATAACAGTAGATCTCTCAGCAGAAACCCT
ATAAGCCAGAAGAGAGTGGGGGCCAATATTCAACATTCTCAAAGAAAACAATTTTCAACC
CAGAATTTCATATCCAGCCA


invisible?    
Gene introns: 0  

>7134 139 324     1p21.3    chr1:94990836-94990974 BLAT!
TAAAATTGCTCATAGAACCCTATGAGCATAGAGTTGACAACAATACCCATCAAAACATAA
TTTATTACTTGTAAAAGGGTTACTTAGGTGTTGCGAGGAAAATAGACTGTAGGGGAGTAA
CTGTGGGAACGGGAGGCTA


invisible?    
Gene introns: 0  

>13166 139 324     4q32.3    chr4:166586130-166586000 BLAT!
GAAGTTCCAAGGAGACAGCCTCTGATGTTTCCAGCTTCACAGCCCAACTCCTGCTCAAAG
TGTCATTCACATTCTGCAGCAATTTCTGGGCTGAGCCCTGACATTTTTCCTCCAGTTCCA
GGATGTGGCTCTTGAGTTC


invisible?    
Gene introns: 0  

>20515 173 324     3p24.3    chr3:16607592-16607420 BLAT!
GCAACATCTCATGAGATCTACTACATGCTGCTGCTTAGGAAAGGAAGGTTGAAAAATAGC
ACTGAGTTTAAAAAATAGCATTTAGAGTATAAGCCTCATGTATTTAATACATGAATGCTT
AAGAAAGATGTTCACCAAATGTTAATGATGCTTATTTCTTGATGGTAGGATTT


invisible?    
Gene introns: 0  

>4137 140 323     3q13.13    chr3:109635668-109635781 BLAT!
ATTCATGCTGTCCTCAGTATCATCATGAGGCTGTATAACATAATGACTTCCTCCAATATA
GTCTGCAGAGATTCCTAGTTGAGAAGCATCTGTTGTAGAACTGTCACCATCCATCAGGTT
CATGCTATGTGCTGGTCACG


invisible?    
Gene introns: 0  

>16003 130 323     2q37.2    chr2:236309724-236309853 BLAT!
TGTTGGAGGTGGGGCCTAGTGGGAGATGATTGGATCATGGCAGTGGTTCCTTATGGTTTA
GCACCATGTCCCTAGTGCTGTCTCATGATAGAATACTCACAAGTTCTGGTTGTTTGAAAG
TGTGTAGCAC


invisible?    
Gene introns: 0  

>2796 158 322     2q14.2    chr2:119636194-119636037 BLAT!
GAGCAGTGCCTGAGCTGACTGCTCCTCTCTATAGCCAACAGCATGGGCTTCCTGCTCCTG
CTCTAGCAAAGGGAATGGGATTTCTTTAGGATGAGCCTGGCTGGATTTCCTGCCAAGGCA
TCTACAGTGGCAATGGGGTTGAAAAGCTAGGAGGGGCC


invisible?    
Gene introns: 0  

>7612 122 322     5p13.3    chr5:29850998-29850877 BLAT!
TACATGCAGCAGCCTGAGCATTTTTTTTTGAGAATGCCTCAATCCCCTCTGCCACTGCAG
ACTGTCCATTTGAACTCTGTATAACTAGTGTTTTCATCCTGGTAGAACAAAATTATGTCT
AA


invisible?    
Gene introns: 0  

>14463 151 321     Xp22.2    chrX:14262867-14262717 BLAT!
AAATAGTCAAAGCGGGACTCCAGTTGTCTTTAAGGATGTCCAGACAGATGACTCCCTGAC
TGTTGATGTTGCAGTGATAGATTCTGGTGCGGAAAGTAACCTTTGGTGGCTTAAATGGAT
AATCTGATGAAAATGTGATATCCAGAAAAAA


invisible?    
Gene introns: 0  

>16978 113 321     13q14.2    chr13:49345768-49345880 BLAT!
GTGGCCAAGGCCTCCAAGGAGACTCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGA
GATGAGGCAGCCTATGGGGAGCTCAGGGCCATGGTGCTGGACCTGAGGGCCTT


invisible?    
Gene introns: 0  

>6278 154 320     2q36.1    chr2:222223665-222223818 BLAT!
CTTCTATCGATTCTGCACCTACTGAAGATCCTTTTTCACATTAAATTTGCTGATTTTGTA
ATATGTATAGGCATAAACATCTGTATTATGTAGATCACTTTTCTGCAATATAGCAAGCCT
GACAGTGTCATAAAAGAAAATTAGGGCAGTCTGG


invisible?    
Gene introns: 0  

>10480 147 320     13q31.1    chr13:85276160-85276306 BLAT!
CCTTATTTACTTTATCTCAAGTAACAAATTGCACCAGCTGGGTCTTTGAAAGTATTCATT
TTGACTTCAAATCACTGGCCAGGGTTTTCGTTTTGTTTTGTTTTGTCTTTTGAGATGAAG
TCTCACATTGTCACCCAGGCTGGAGTG


invisible?    
Gene introns: 0  

>16417 151 320     1q41    chr1:218814962-218815112 BLAT!
TTCTCATTTTGTCTTGATTTGTGCATGTTTCTACTCTCTCATAACATGATCAACACAGTC
AGATTCTCCTTCAGCACTGGAATAAGTTACTGATTCTTGCTGTGCCTCAGGAATCAGAGC
TGGTTCGTGTTTAGGGGCTTTTTTCAGTTCT


invisible?    
Gene introns: 0  

>16454 135 320     3p24.3    chr3:19174786-19174652 BLAT!
AGATATTATTTTCCAAAATAATGATACATTTTAAAAGAATATAATTAATAGTTAACTTTT
CACTAGTCCTTTCTTTCTTTCAGCTGATAATTTTATGTGACAATAACAATGTTTTTTGGG
AAGTTAGAGAGCAGA


invisible?    
Gene introns: 0  

>20443 174 320     8q22.1    chr8:94122073-94121900 BLAT!
CTTCTTCCTCTTACTCCTTTTTCCCTTCTCCTTAGCAAAGTTTTGAAAGCCTTTTTAAAC
CCTCAGTTAAGAATGATTTTTAAAACATATAATAGTTCCCTACAAATTCCTGTCCCAAAT
AACTCTAACTTTTTATTAATTAAGTTTCTAGGGAAGTAGTATTAATGAGAAAAA


invisible?    
Gene introns: 0  

Shown 1231-1260 from 1945 sequences on 42 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs