Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1261-1290 from 1945 sequences on 43 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>6918 103 319     3q29    chr3:195207231-195207333 BLAT!
TCTGTGTGATATCACAGTGGTGGATATAGTGAAGCTCCTCTGTGCGATACCACAGTGGTG
GATATAGTGAAGCTGCTATATATGATACCACAGTGGTAGATAC


invisible?    
Gene introns: 0  

>8922 151 318     13q22.2    chr13:76608557-76608407 BLAT!
ATAGAGGCTGATTACTTGTTTAAGTAAAAGGAAAGAACTCCAAGTAGATTTCATTATTTG
CTTACTGTTATAACTCATACTTAGCTTTCTATCCAAAGCTTCTTAGTCTATACTCAATCT
GCAGAATCAAATACATTTCAAATGAAGTGTT


invisible?    
Gene introns: 0  

>19002 136 318     3q13.2    chr3:111962823-111962688 BLAT!
TATTCCTGTGGAGAGAAAAACATTCTAAGTATGGTAAAGAAGTGCTAATAATAAAGAAAG
AATCCATATACAGCCTAGGCAACATAGTGAGACCCCCGTCTCTACAAAAAGTTTAAAAAT
TAGCCAGGCGTGGCAG


invisible?    
Gene introns: SLC9A10 (111859751 - 112013074)  

>22818 119 318     4p11    chr4:48454927-48455045 BLAT!
GCTTTATTCATAATTGCCAAAACTTGGAAGCAACCAAGATGTCCTTCTGTAGGTGAATGA
ACAAATATGCCCAGATAATGAAATATTATTCAGTGCTAAAAAGAAATGGGCTGTCAAGT


invisible?    
Gene introns: 0  

>9808 161 317     10p12.31    chr10:19923585-19923745 BLAT!
ACAGCACTCTTTTCCGTAATACTCATCTGGAAAGCAAGCAGAGTGAACTAGACCAGGGAC
CTCAACGTGGTTGCACAGCTAAAAAATAATCATAGGCTGTAAGAAGTCAGAACGCTATAA
AAACTTAGCAAGAAGAGTTAGATGCCACAGACCTATTTGAA


invisible?    
Gene introns: 0  

>4600 162 316     16q23.1    chr16:75227081-75226920 BLAT!
AACTAACGGGTGTATTTGCACCTCGTCCATCGACAGGTCCCCACAAGCTGAGGGAATGTC
TTCCTCTGATCGTCTTCCTCAGGAATAGACTCAAGTATGCGTTGACTGGAGATGAGGTAA
AGAAGATATGTATGCAACGTTTCATCAAAATTGATGGCAAGG


invisible?    
Gene introns: 0  

>14098 155 316     16p13.11    chr16:16565569-16565723 BLAT!
TTCCTTGCTTTCCAGCAGGTGCTCCTCCCAGTAAACCCCCTGCACCCAGATCTCCATCCC
ACAGCTTGTCTCTCTAGAAACCTGACCTATGACAGGCTTATAAACACCACAACAGGGCAT
GGGTATGGGCCAGGAGAGCTACTCCTCTCATCTGC


invisible?    
Gene introns: 0  

>14451 146 316     4q34.1    chr4:176126089-176126234 BLAT!
ACCATGTTGGCCAGGCTGGTTTTGAACTCCTGACCTCAAGTAATCTGCCCGCCTCAGCCT
CCCAAAGTGCTGTTATTACAGGTGTGAGCCACAGCGCCCGGCCAAAAACAGCTTTACTGA
AGAGGTATTACAGCTCCAGCAGTGTT


invisible?    
Gene introns: 0  

>15313 138 316     7p12.2    chr7:49079579-49079716 BLAT!
TTTCCCTAGCTCCAAGTGGTTCAGAACAGAGAGTGAGAGAGACTATGTATGTTTGGAAGA
AAGTAAGAGAAGAGAACAAGAGTCTCTGCTTAGAAATCCAGAGAATTCTCCCGGAATATG
TCCAAGATTATCAAGGTG


invisible?    
Gene introns: 0  

>7063 124 315     7q32.1    chr7:127837897-127837774 BLAT!
TCTGGAAGAGGCATTCACTCTCCAGGCCCTGCCCACCACACAGTGACCTCATCTGGGCTG
GCAAGAAGGCCTCCAGTGACCCACACAGCTTCCTGGGTTGCGGTTCCAGACTCAGCCATG
GGGC


invisible?    
Gene introns: 0  

>13711 149 314     16q21    chr16:62459671-62459523 BLAT!
TCTAACATGAGATAGGTTCCATGAAGTTCTACTGCACTTTCTCTGTGTTCTTGGCTAGGA
CTGGTTTAAATCAGAGAAAAAGGGAAGAAAAAGGAAAGGGACAAAAAATATTGTTATGAG
GAAAGGGCTAAGAATATAGGAAGAATTGG


invisible?    
Gene introns: 0  

>19612 133 314     14q12    chr14:25166681-25166813 BLAT!
AGTGAGTGGAAGGTGAATGAGCGAGTGGAGGAGTAAGTGGAAGGTTAGTGAGTGGAAGAA
GTGTGTGGAGACAAAGATTGCTGACAAGAACTCATAGTATTTCGCTGTGTTGTGCGGGAT
CTCCATGCTGAGA


invisible?    
Gene introns: 0  

>21226 130 314     14q21.2    chr14:45030577-45030448 BLAT!
TCTAGCTACTACTCTTTCTGGAGGAGAACTTCAAAGATAATTCTTGATTTTTATGATAGT
TGTGTTCCTGGAACATTTCCTGAATTATTCATTATGACTTCCTTAAAAAAAATGAAGCAT
AGGTTCTGTT


invisible?    
Gene introns: 0  

>4341 140 313     4q28.3    chr4:138336765-138336626 BLAT!
GGAACCTATGGCCATTTACACAGGCATTTTGAGGAAAGTAATACTTACACATTTTGAGAA
TTATTGAACACCAGGTTTGAGTTGGCACTTGTAACTAAAGATTCAAAGTGTCATCATGGT
CCCACTTTTAGAAAGGAGGT


invisible?    
Gene introns: 0  

>10906 113 313     Xq12    chrX:64643888-64644000 BLAT!
TCTGCATCTATTGAGATAATCATGTGGTTTTTGTCATTGATTCTGTTTATGTGGATTGTA
TTTATTGATTTGCATCTGTTGAACCAACCCTGCATCCCAGGGATGAAGCCGAC


invisible?    
Gene introns: 0  

>22440 129 313     6q24.1    chr6:141873080-141872952 BLAT!
ATATGCTTGCCTATACAACATGTCAAAATTTCAGCTGAAAATTATGAGGCATAAAAAGGT
GAGAATAAATATAATATTGAAATACAAGGCAATATAAGAATCAGGCTCATATGTAAGACA
TATGGCAGG


invisible?    
Gene introns: 0  

>5220 157 312     16q23.3    chr16:83865003-83864880 BLAT!
TGCCAGCTGTGTCGGACATGACCAGGGACACGTTGTACCGCTGTCAACTCTGGAGTCAGA
CAGCTTGGGTTAAAATCCCAGCCTTTGTATTTACATGCTGTGCAATCTTGAGCAAGTAAC
CTCACCTCTCTGGGCCACAGTTTCCTCGGCTGTAAAG


invisible?    
Gene introns: 0  

>8683 159 312     9p11.2    chr9:47030224-47030382 BLAT!
CTAATTTTCCAACCCAGACCAAGAGAACATATAGGCCACAGACCTTGAAGATCTGCCTTA
GAATGGCAATTATCTTTTTTCCATAAGGAAATGTGAGATGTAGAGCCTGTTTTACTTTGC
CTGTTTCGTTGATTCAAATATAGTGAGAAGTATTAGCAA


invisible?    
Gene introns: 0  

>8917 115 312     4p15.1    chr4:34483738-34483624 BLAT!
GCCTCCCAAAGTGCTAGGATTACAGGCATGAGCCACCGCGCCCGGCCTTACCTGATTTCT
TAATCAACAACCAAATAATTTCACTGCTTGCTTTGGGTGAAAATAAATTTTGCTA


invisible?    
Gene introns: 0  

>15158 152 312     Xp11.4    chrX:38864922-38865073 BLAT!
AGTTGGGAGGCTGAACTCTTTAAACGTTGATCTAAAGAAAGCGCTTCCTGGGATTTTCAG
TGGTGGAACATTACTGGATGAGTAATGGTCTTGAGCATTCTTGTTAGGTAAGATGTTTGG
TCTTAAAACTGGGACAAATCAAAAGGCCATTT


invisible?    
Gene introns: 0  

>16309 123 312     14q21.1    chr14:39466613-39466735 BLAT!
TTGCCTTTTTTTGATTTTCTTTCAACCATTTCAAACTGAGAAACACATTCTTAGCTTGTA
GGCGATACAAAAATAAACAGGGATCCAGAATTGATTCATAGACCATAGTTTGCCTAGAGT
ATT


invisible?    
Gene introns: 0  

>16634 133 312     4q31.23    chr4:150897879-150897747 BLAT!
TGTTTTCTAATTTTAAAAAATCTTTAAAGGGCACCAATTTTTCTCTAGTTAATAATAGAA
AAAACACTGTATTTATATGATTAAATTCCCAGAACCCTCAATTCCTTAGGGATGGACTAA
AGGGCTGCTATCA


invisible?    
Gene introns: 0  

>12605 162 311     6p21.2    chr6:39738847-39738686 BLAT!
CCTAACTTAGGATAATTTGGCAGCGGTCATGCCAATGACCAAGGTAGGGAATGAATCAGG
GGAGGCATTTCTGAAGAGGAGAACATGGTAAGCTCAGTTTGGGATATTTAATGAGTCACA
TTCAGTGGTTATTAAAAGGGGAGTCTGTTGCTCGGAAGAGCA


invisible?    
Gene introns: 0  

>21156 111 311     5q31.3    chr5:141441274-141441384 BLAT!
AGACCTTCAGTAAAACCTGCTGTATACAGTAGCCTGGTGTTGGTGGTGACTTGGGGTCAT
GCATGAAGTGAGTGGGACTCACTTGAGGTCAACCTCAAAGACTGACCTTAA


invisible?    
Gene introns: 0  

>5508 108 310     4q31.3    chr4:152734392-152734499 BLAT!
TGCCTAAGGAGGTTCAGCATAGCCTTGCCAGTAAGGATTATTTATTTACTTTAAGAGTTA
AGAGTGGTGGTTTGGGGATAGCACCAGGAGATATCAGCTGTGATGGCT


invisible?    
Gene introns: 0  

>6614 113 310     13q31.1    chr13:80030273-80030385 BLAT!
CAAAAAAAAACATGCTTTCTCAAGACATTTTACTGCCTTCAGCCAGAACATCACGGTGAT
AAATACCAAAATTCAGTGAAGACAATGGATGTGAACAGCTCTCCCCAGAATCC


invisible?    
Gene introns: 0  

>9032 107 310     8q22.3    chr8:101679814-101679919 BLAT!
AAAATGATCATTGAAATGCAGAAAACTGCAAGAGAAAAAGCCAGGATCCCCTCTAAACAA
CATCGATGATGCAACAATAACAAAGCTTCCTGCCTAAGATTGGCAGG


invisible?    
Gene introns: 0  

>11918 135 310     1p34.2    chr1:42520879-42520745 BLAT!
AAAGAGTAACAGAAAAATAAACTCACTCTTCTACAGTATACGTATATTATGGGTAGTCCA
AACAATGAAAACCACATCAATCACAAAATCAAAGTGCAAAAATTGCTAGCATTCCTATAC
ACCAACAACAGGCAT


invisible?    
Gene introns: 0  

>14955 147 310     20q13.11    chr20:41974113-41973967 BLAT!
GTGTGGTGGCTCACACTTGTAATCCCAGCACTTTGGGAGACCAAGATGGGTGGTTTGCTT
GAGCTTACGAGTTCAAGACCAGCCTGGGCAACATGGTGAAACCTGTCTTTAGCAAAAATG
CAAAAAAATTAGCTGGGCATGGTGGCA


invisible?    
Gene introns: 0  

>20709 136 310     7p12.1    chr7:52676868-52677003 BLAT!
CTGATTTTTTCCCTCAAATGTAACAACAGTCTTTTAATTTAATCTCTATTTCCAAGATTG
GCCCTCTCTCTCCAGGCAAGGCTGCTACCTCTGCTAATGCTGCTTGTGCTACTGCTGCTG
CTGCTACTACTACCAG


invisible?    
Gene introns: 0  

Shown 1261-1290 from 1945 sequences on 43 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs