Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1291-1320 from 1945 sequences on 44 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>13900 152 309     10q21.1    chr10:55647029-55647180 BLAT!
TGTTTTACCAAGCATTAAATATCGAGAATTCCTTAACATTAAGTAAAGAGAAGACTAATA
TTTAGATGGAATAAACTATGCTAACCAATAAGAAAAATACTAGCTTATCCCCTTTTGTCA
GAATTATTTTATCTTCCATGAAGAATAACTTA


invisible?    
Gene introns: PCDH15 (55568451 - 56561051)  

>17434 134 309     21q22.3    chr21:48089432-48089565 BLAT!
GCTGGAGACTCCCAAAGGAGGCAAGCAAGCCTCAGCGATCCCAGGAGGCCCCATCGGCCC
TTCCCAGGCTTTCCTCTCTTTAAGCTCCTCCTCCTCCTTCCCTTTCTTCAGAATCGAATC
TAGGCAAGGATTTC


invisible?    
Gene introns: 0  

>2853 122 308     2p14    chr2:66351892-66351771 BLAT!
GCTGAAGGACAAACAAGCTCCCCTGAGCCTCTTTATAGGAGAACTAATCTCATTCTTGAG
GGCTTTGCCCTCAATAGGTGACCTAATCACCTCCTAAGGGCCCTACCTCTTAATCCTATC
TC


invisible?    
Gene introns: 0  

>11147 160 308     5q23.1    chr5:116689783-116689624 BLAT!
AAAGCCTCAGAGAACTTACAATCATGGCAGAAGAAAACTCTTCACAGGACGACAGGAAAG
AGAATGAATGCCAGCAGAGGAAATGCCAGATGCTTATAAAACCATTAGATCTCGTGAAAA
CTCACTCACTTTTACGAGAACAGCATAGGCAAATCCACCC


invisible?    
Gene introns: 0  

>12516 157 308     6p22.3    chr6:23430473-23430317 BLAT!
CTACAGAACTCTCCACCCTAAATCAACAGAATATACGTTCTTCTAAGCACCACTTCGCAC
TTATTCTATAATTGGCCACATAATTGGAAGTAAAACACTGCTCAGCAAATGCAAAAGAAT
GGAAATCATAACAAATAGTCTCTCAGACCACAGTGCA


invisible?    
Gene introns: 0  

>21820 146 308     9p22.3    chr9:15055517-15055372 BLAT!
TTGTTTTTCTGCCTTTCTCTTTCTCCCCCTTCTGGCAGCTTTTGGAGTAGTTATGTCAAC
TGCTTTAGTCACATCCTCATTGCTGGCTTTTTCTTCATGGTCGGTATCTTCCTTTGAAAC
ACTAGTTTCCTTTTCTTCAACTTCAA


invisible?    
Gene introns: 0  

>2799 121 307     2q23.3    chr2:153977761-153977881 BLAT!
TACAAATAATTTAAAAACACATTTTTTTCTAATTTCAAAAGCAGTCCATTCCTCCTGTGG
AAATTAGTTTTAGAAATCTAAAATAGATGAAGAAATGAAATGCTTTCGTTCAGTGATTAC
T


invisible?    
Gene introns: 0  

>7981 163 307     17q22    chr17:52296807-52296646 BLAT!
ATAACATCGATTACCTATGATAAAAACACACAATACAAAAAAATATTAAAGTGGTATTTT
CAAGCTGTTATCTAGAGCAGAAGGGCTTTAAAATGAATTTCTTTCCGGAGCTTTGAACAT
TTTGGAGTCTAAAAACTTCATTAATTTATCAGTAAAAGCCTTG


invisible?    
Gene introns: 0  

>8418 111 307     3p25.2    chr3:11803166-11803276 BLAT!
ATCCCAGCACTTTGGGAGGCCGAGGCGGGTGGATCACCCGAGGTCAGGAGTTCAAGACCA
GCCTGACCAACGTGGTGAAATCCTGTCTCTACTAAAAATACAAAAATTAGC


invisible?    
Gene introns: 0  

>13926 125 307     6q16.1    chr6:94724594-94724718 BLAT!
TTTTCACCCCTAGTTCAAAAGTAGACTGTAGATGGCCAGAGAAGAACACTTTCTGCTTCA
AAACTGAACAGAATGGGAAAATATTTAATTGAACATCAATTAATCTATTCACTTAAATAT
TTATT


invisible?    
Gene introns: 0  

>21934 140 307     21q21.2    chr21:25194150-25194289 BLAT!
AGTAGAGACGGGGTTTCACCGTGTTAGCCAGGATGGTCCGCCTGCCTCAGCCCCCCAAAG
GGCTGGGATTACAAGCGTGAGCCACCGCGCTCAGCCAACTTCTCCCTTCTTAAGAGTCCG
CTGTGCATTGTGACTTCAAT


invisible?    
Gene introns: 0  

>6541 131 306     2p24.3    chr2:15275054-15274924 BLAT!
CCTGGTAGTTTATAAGACCACACTTTCCAAACAAGCTCCGACCCATTAGAGGGGATCATA
CATAATTCAGGAGCCACTTGTTACTGCGTGTATCATGCAAATTCTCTCAAATTACATTTG
GAAAAAATGAG


invisible?    
Gene introns: 0  

>10416 139 306     5q34    chr5:160345134-160344996 BLAT!
GCTTGATCATCTGCATCCCTATTAGGGCCCTCAGTGTGAAAAGGGAGAGTAGGGAGAGTA
GACAGAATGAGAACACGCAGCTCTCCTTCCTCACTGTGGTCCTATGAGGATGTTCCTCAG
CTGACTGTGCAGATAAACC


invisible?    
Gene introns: 0  

>15077 104 306     1p31.1    chr1:73429116-73429219 BLAT!
TGCCCAAAGTAATTTATAGATTCAATGCTATCCCCATCAAGCTACCATTGACTTTCTTCA
CAGAATTAGAAAAAAACCACCTTAAATTTCATATGGAACCAAAA


invisible?    
Gene introns: 0  

>19163 134 306     3p22.1    chr3:39782444-39782577 BLAT!
ATGTCTACATCTCCTTCAGTTCACCTCTGACCTCAGTTATTTTTGTCTTCTGCTAGCTTT
TGAATTTGTTTGGTCTTGCTTCTCTAGTTCTTTTCATTGTAACGTTAGGGTGTCGATTTT
CATCTTTCCCGCTT


invisible?    
Gene introns: 0  

>4452 141 305     13q21.33    chr13:72657653-72657513 BLAT!
GATATGTGCATATTTTCTACCTTTAGCTTACTGATGAGTAAGGAAGGATTGAAAGGAAAG
GTAACTGTGGATTGCTGTATGTTTCTCTTTCTTTCAGAGTCATCATTTTCAGCATACGTA
GTTGACCAATACATAAAAGAA


invisible?    
Gene introns: 0  

>11032 114 305     17q21.32    chr17:45509051-45508938 BLAT!
AGTCAATAAATCAAGCCTCAACAAACTTCAAAAGACTAAAATCAGAGTATGTTCACTGAC
CACCACAATGCAATTAAACTAGAAATTAATAATGTAATGACTATAAAACCTCAA


invisible?    
Gene introns: C17orf57 (45401326 - 45518677)  

>19255 139 305     3p24.3    chr3:20482387-20482277 BLAT!
CATAAACACATGAACAAACACACAAAAATGAACTAATAAAAAACTCTACACTTTAACTTC
ATCCCCCACTTTTTAACTTTTGGTTATTTCTCTTTATGTCTTCTTATCTTACCCCGGTAC
ATCCCTGTCTGGAGGGAGG


invisible?    
Gene introns: 0  

>8536 122 304     4p15.1    chr4:31264264-31264143 BLAT!
GAGATGGAGAAAAAGAGGGAAATAGTCACTAATAATAATAATAAATGAATAACATAAAAG
ACAAATAAATAAGATTTTGTAAACCAAGCAGTTGGAGCCCCAAAAGTGGTCTTTCTAAAA
AG


invisible?    
Gene introns: 0  

>14889 120 304     3q13.13    chr3:109791786-109791905 BLAT!
TATCTTGAAAGTAACCAACTTGTTTTTTATTTTACATGCTCATAGGTAGAAAGAATTTTC
TGTGTCTCAGTTGAGACTTTGAACTTTTGAGTTAATGCTGGAATGAGTTAAGATTTTTCA


invisible?    
Gene introns: 0  

>16934 154 303     21p11.2    chr21:10368669-10368822 BLAT!
TGTATTGATTAAGTTGCTAGCTCTTAAAGGTATGGTTTGTGGTTTCTCCCCATATTACAG
TAGCAATATCAAAGATCACTGAATACAGATCACCATAATAGATATAATAATAGTGAAAAA
GCTTGCAATATTGTGAGAATCACCAAAATGTGAC


invisible?    
Gene introns: 0  

>17299 153 303     5q14.3    chr5:89396933-89397085 BLAT!
AGTAGGCAAATTTAAGACTTATTCAGTCATGGGGAACTAGAACAAACTAAATAGAAGAAT
TCAAGTGTTAAAATTCTTATTTTCTTACTTACATGTCTTCGTTTGCCATATTTTCCATAT
GCAAATATTTCTGGCAGGCTCAGTGCTTCTCTT


invisible?    
Gene introns: 0  

>19349 111 303     10q22.1    chr10:74765646-74765536 BLAT!
GAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAATAAAT
TCAGCATTAAAATAAATGTAATTAAAAGGAAAAAAAAAGAAATATGGTGTG


invisible?    
Gene introns: 0  

>17830 137 302     11q23.3    chr11:117999623-117999487 BLAT!
GTTTGCAGATCTCTGGAGCGCTGTCTCTGTGAAGCTGTCTCTTCTCTGAGATACTGCCCA
GTGAGCCCTATCCACAGGACTCCTGACTCCATCTCCTTGATTCTGAGAGGTTGCCAGACT
CTGCCCGAGTCCCCTTT


invisible?    
Gene introns: 0  

>20520 105 302     21p11.2    chr21:10819555-10819632 BLAT!
CAACGCGAGTGCAGGGGAATGGAATGGAATGGAATGCAACGGAATGGAATCTTCCGGAAT
GGAATTGAATGGAATGGAATGGAATGAAATGCAATGGATTCAACT


invisible?    
Gene introns: 0  

>20975 141 302     3p11.2    chr3:87567171-87567311 BLAT!
ATTTTAAGACCAATATGTCACTTTTCTTCCTGAGAATGCTATTCAATTAAAACTGAGACA
TCAAAGTTCTTATACACAAAGAGTTTCATTATGCAACCTCATTATGAGGTCTAAATTACT
GGATATATGAATATATTTAAA


invisible?    
Gene introns: 0  

>22008 154 302     1q24.3    chr1:172718463-172718310 BLAT!
GCATATGAGTTTTGATAACATCCGCAGGTTGAGTTACCAGTGAGGCCAGAATACCAGCAA
ATATCCCACAGCTGAAATTTGTAATAGGAATAAGGGTTGCATCCACCTGGTCATGAGGCA
CTATATTTTTGGTCTGGTTGTAAAACATCAGGTA


invisible?    
Gene introns: 0  

>3042 123 301     6q24.2    chr6:143046682-143046560 BLAT!
CAATTATCGCTGCTCCAGGAATCTGGTGCATCAGGAATGCCCTCTTCTGCTGCACCCTGC
TTAAGTAATCTTTGGCAAATCATTTTCCTTGTTCTTTGTTTCCTCATCTGGTAAGCAAGG
AGT


invisible?    
Gene introns: 0  

>5874 136 301     2p23.3    chr2:26130088-26129957 BLAT!
GTCAGGCTGGTCTCAAACTCCTGACCTTGTGATCTGCCCGCCTCAGCCTCCCCAAGTGCT
AGGATTACAGCCATGAGCCACTCTTAGTCCATTTGCTGCTGTGACATCAGAATACCACAG
ACTGGGTAATTTATAA


invisible?    
Gene introns: 0  

>14372 151 301     2q24.2    chr2:161378143-161378293 BLAT!
ACATCATCAGCCAGTAGGAAAATTCAAATCAAAACCACCATAAGATACCCTTTCATATCC
GCTAGGATGGTCATAGCTAAAAACCAAACCAAGCAAGTGTTGTCCAGGATGTAGAGAAAT
TGAAACCCTGAAACATAGACTAATAGACTAC


invisible?    
Gene introns: 0  

Shown 1291-1320 from 1945 sequences on 44 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs