Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1321-1350 from 1945 sequences on 45 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>3988 113 300     16p12.3    chr16:18380536-18380648 BLAT!
TTTCAGATTATCAGCACCATGACCCTGCTTTTGAGACCCCTACTCTCTCTCCCTTCCCTA
TTATCTCTTGGTGAATATTGGGGAATGGCTCACCTGAACTGCCCCACGATTTC


invisible?    
Gene introns: 0  

>15510 110 300     1q43    chr1:242865462-242865571 BLAT!
CACCACGTCTGGCTGTGTTAGGGATTTTTATGAAATAAGTAGATCTTAGCTGCTCTTGCC
ACAGAAAAAAGGAACTATGTGAGATGAAAATATGTTCATCTTCTTCACTA


invisible?    
Gene introns: 0  

>16402 175 300     22q11.1    chr22:16886167-16886056 BLAT!
GAGAAAATATTGTTATTATTATTATACTTCTTTCTTCTTCAGTATTAGTGGACCCACATT
ATCTCCTGTCAATTCATTGTGTTTATTATGTGAACCACCGCAGGCAGGAAACGTTTTAGA
ACGCCAACACCTACAATAAGCTGCTTTAGTAAGACACAAATCTTCAATGTTTATT


invisible?    
Gene introns: 0  

>18030 112 300     14q12    chr14:25166516-25166405 BLAT!
CTCACTCATCTTCCACTCACTCACTCCTCCACTCACTCATCTTCCACTCACTCATTTTCC
ACTCACTCACTCCTCCACTCACTCACCTTCCACTCACTCATCTTCCACTCAC


invisible?    
Gene introns: 0  

>20363 129 299     4q22.2    chr4:94307555-94307683 BLAT!
AAATATAAGTCTTCAGTAAATATAAACCACCATTATTAAATAGGAGATGTTAAGAATTGA
GCTGAGCTGGGGAGGGCTGAGCTACCAGATGTGGGAGTATTCAGTAAGACAACAAGCCAA
AATGAAAGT


invisible?    
Gene introns: GRID2 (93225549 - 94693649)  

>21062 110 299     3q29    chr3:195219819-195219710 BLAT!
TCATACAGAGCAGCTTCACTGTATCTACCAGTGTGATATTACACAGAGGAACTTCACTAT
ATCTACCACTGTGATATCATACAGAGCAGCTTCACTGTATCTACCAGTGT


invisible?    
Gene introns: 0  

>7445 109 298     2p22.3    chr2:36306494-36306385 BLAT!
GGGATGCCTCTTAACACACAGACTTGCTTGGGACCAACCACTGCCATAATTGATCCCTTT
GGAGGCTGAAAGAGCTTTGCTTGATTTCAAACCAGGGAAAAAATGGATG


invisible?    
Gene introns: 0  

>7501 121 298     17p11.2    chr17:21244765-21244870 BLAT!
GGTCAGGCTGGAACTGAGGCTGGACCAAACACAAATGCCTAAAGGGTTTCCAGGGGATAC
ATTCTGGGATCCAGAGTCAGGAACTACTTTGTGGGAACCACTTGTTCCCTAGCCCCTGCT
C


invisible?    
Gene introns: 0  

>15235 106 298     14q21.2    chr14:43770210-43770103 BLAT!
GTACTGAAGTCATTTGTCAAATCTAGGCGTCTTTTGGAGGAGTCTTTCTCATCAGCAGAG
ACAATCTGACTTTCTTTTTTCTTTCTTTTTTTTTTTTACAAAGCAA


invisible?    
Gene introns: 0  

>18965 142 298     13q21.1    chr13:57899891-57899750 BLAT!
AACAGAATAAGAAAGTTTAGAACTTATCCCATTAAAACATTAAAATTTTTTGAAGCACCA
TGTTTGTTAAAAAGTGAACTTCAGAGATAGACAAAGAAAACAGCAGCAATAAGTGTGCCC
GTAACTACTGTGTTCATATACT


invisible?    
Gene introns: 0  

>19077 120 298     1p21.1    chr1:103690642-103690523 BLAT!
ATGGCCCTGCTACCACAGTTCTCCTAGGCACTGCCCTACTAGAAGCTCTCTGCTTGTAGC
TCTGCCTTTGCTGTAGACTTCTCCATGGGTTCCCAGGATTTCTGATACATCCTCTAAAAT


invisible?    
Gene introns: 0  

>8406 156 297     4q26    chr4:119769169-119769014 BLAT!
AGGAAGACAAGAAATAAGAAAACAAGACAGAAATTACAGAAGAAAGAAAGAGATGTGAAA
ATCATCTGAGAAATTAGTCAACATCTGTGGAGACTATATAGGAATATAAAAGTTAGGGTC
CTTAATATTAAGAATAAAAAATATTAAGACTTACTG


invisible?    
Gene introns: 0  

>15086 135 297     Xq11.2    chrX:63273932-63273798 BLAT!
ACTCTACTCCAGGTAACTGAGATAAAAAGAGGCATCCTAAACAAGATTTCTTCCATCCCC
AGGCAAACCAACCTAGGTATGTCTCAGAGCACCTCATTGAAGTTTCCAAAATCTTTGTTG
CCATGCTGGGTTTCA


invisible?    
Gene introns: 0  

>20379 126 297     2q24.1    chr2:156640118-156639993 BLAT!
TTTGCCCATGTATTCTAAATGGTATTGCTTAGGTTGTCTTCCCAGATTTTTATGATTTTG
GGTTATACATTTAAGTTTTAATCCATCTTGAGTTAATTTTTGTATAAGATGTAAGGGAGG
GGATCA


invisible?    
Gene introns: 0  

>9755 158 296     14q32.12    chr14:92765448-92765291 BLAT!
GCTCCAAGTGTTGCAGTCAGGACCCCATATCCCTCACCTGGTCCCCTAAGGCTTCACCTT
CAGGGAGGAAGACCTGGGTAGCCACATGGGCAGGCGAACCAAAGGGGGCCAGAGAGACAA
GCATGGACAAACTAGGTTTGCTAAGGGAGACCTTGGGG


invisible?    
Gene introns: 0  

>20991 187 296     11q12.1    chr11:56158265-56158451 BLAT!
CTTAATTGCCATTAAAAGCCAATACAGCAAAACTAAAGCAAATGTAGCAAATAATCAAAG
TAGATATAGCCATTAATCAAATTGCTTTCCCAAAAGAGATCATTAAAATATTCCTCTACT
CCCTATTCATTTATTGACTAATAGTTGAAAGAGTGATCTACCATTTCAAGGGAAATAGCT
TTTTCCC


invisible?    
Gene introns: OR8U8 (56143099 - 56508560)  

>21400 130 296     3q12.1    chr3:99191516-99191387 BLAT!
TGTGTCTAATACTGTTGGAACAGGCGTTTCAGAAAGAAATGAGAGGCCCAGTCTCAGTAA
CTCCATGAAGGGTGCCGAGCTCCTCTGTTGAGGATTTGGCTTGTGAGAGGCAATGTTCCT
ATCATTTGCC


invisible?    
Gene introns: 0  

>21582 150 296     2p13.2    chr2:72396507-72396656 BLAT!
AAGACTTATTGAATTTTAGGAAGGCAATATGGCATATGTGCCATATATAACACCCTCAGT
AGGGTTTGGGAAATAGACATAATCAAATATGTTACTTTTTCTGTGTTGAAAAGTATAAAT
ATCCACATTAAGTGGGATAAATACAGATGA


invisible?    
Gene introns: 0  

>4743 107 295     10q21.1    chr10:54303758-54303864 BLAT!
AACTTTCAGAAATTGATACATACTTTTACATCTGCCACTCATATTTTCAAAGTTCATGTC
TGGACAGTATGGTTAACTTAAAATTTGAGTTTCATTTACATGAAAAT


invisible?    
Gene introns: 0  

>10777 136 294     6q15    chr6:93037169-93037304 BLAT!
GATAGTTTATGTATAAAGTCTTCCTGGACCTACACCAGGATAGCTGAATTCTATTATATT
ACATGCAATTACACCATTCTCAATTCAGCATCTGATAGTTCTGATGAATGTTCCATTTAT
TTCCACAAGACTTATA


invisible?    
Gene introns: 0  

>20074 154 294     2q35    chr2:216007542-216007389 BLAT!
TGCACATACAAAATGGGAGGCTGAGGGGGGCGGATCATGAGGTCAGGAGTTCGAGACCAG
CCTGACTGACATGGTGAAACCCCATCTCTACTAAAAATACACAAATTAGCTGGGCATGGT
GGCACACGCCTGCAATCTCAGCTACTCAGGAGGC


invisible?    
Gene introns: 0  

>10552 151 293     3p21.33    chr3:44085368-44085218 BLAT!
GGTTTATGGGTTGGAAATTACTGGAATTCTCTGCATGTTCTAGTCTGTAGGAAAGTAACA
GGTAGGAACTCTGAGGAAGGTTTTCTCCATGCTGCAGAAAGGGCTCAACTCCATGAAGTC
CCTATACCAAAAGCAGGGCTGTGTCTAGCGG


invisible?    
Gene introns: 0  

>22283 161 293     12q13.12    chr12:50246493-50246333 BLAT!
TTGTTGTTGTTTATTTGTTTCTTTGAGACAGGGTCTTACTCTGTCCCCCAGGCTGCAGTG
CAGTGGCGCAATCCCAGTTCACTGCAACCTCCGCCTCCAGGGTTCAATTATTGTGCCTCG
GCCTCCTGAGTAGCTGGGATTACAGATGGTGCCACCATGGC


invisible?    
Gene introns: 0  

>9778 182 292     6q24.2    chr6:143047736-143047917 BLAT!
CTATGGGATGGCAAAGCCCTATACAGCAATGTGAGCACTTGCTTAACATAACAGAGATCA
TAAAAGATGAGCAAGCGCAACAGAGCAGATAACCTTGTCATTTGTCATAATTAACAAGAA
TGTGGAGGGGGTGGTGGGCAGTTTGATAAAACTGGATGGAAACGAAGCTGCCCATTCAGT
GT


invisible?    
Gene introns: 0  

>14991 145 292     1p13.2    chr1:114861799-114861655 BLAT!
AAAAGGTATTTTTAAACCACCAACTCTTTCCGTGAGAAAAAAATTCCACTCTGCCAAAGA
GAACATATTTCAGAAAGAATAATTTAGGGAGTCCAGGGACCTCAGAAACCATCAAAAGAG
GCAAAACAGAGTTGTATAGTGGCCA


invisible?    
Gene introns: 0  

>5332 117 291     6p22.1    chr6:27979822-27979714 BLAT!
GGCCCTGCCCATAAAGTAGTGTTGCAGTCGTTCTTGAGCTTGGGCATGGAGCTCCCTACT
GACCACATCTGACATTGGAGAGCCCAAATGTCTTCTGACATAGTCATCCACTCGTTT


invisible?    
Gene introns: 0  

>13183 129 291     11q12.1    chr11:56847607-56847735 BLAT!
TTCACATAAAGGCTTGGGTGCTGCCTCATTCTGGACCTTGCTATGAACTGGGCCTGGTTA
ATGCCTGCCCAAATGATAACACAGTAATGTCCAAACTCAACAGGGAATATTCTATTTCTT
TCTATAACT


invisible?    
Gene introns: 0  

>20063 110 291     2p13.3    chr2:70867262-70867153 BLAT!
GGAGGAGGCAAAGGAGAATCCCCCTCTAAAGCTTTTGGAGGGAGCCTGGCCATGCCCACA
CCTTGATTTTGGATTTCTGATGTTGTAAAGGCACCCAGTTTGTGGTGCTC


invisible?    
Gene introns: 0  

>4788 135 290     20p12.3    chr20:8876399-8876533 BLAT!
TGTCTGTTGAGTTGTTTGCTTTTTGTTTCAGCTCTTGCATATTTTTATTTCTAGACATTT
TTTGGCATTCTTTTGGAAGTGCTAGATCACTCTTCATAGTTTTCTGTTCCCTGAACATTA
TTTCTACTTGTCTTT


invisible?    
Gene introns: 0  

>9285 144 290     7p22.1    chr7:4632743-4632886 BLAT!
CTGAGTTTGTCCTGAGCAATTGTGGTAGAATTGACCTCGAGGTGCCCAATCTATAATAGT
TCCGAATTCATTGTTTTGTAATATCACCGCACTATTGGCCACACATTCTTCCCAAACTAA
AACTTCTGTATTTTTTGATTCTTT


invisible?    
Gene introns: 0  

Shown 1321-1350 from 1945 sequences on 45 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs