Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1351-1380 from 1945 sequences on 46 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11726 143 290     10p14    chr10:8655740-8655598 BLAT!
AGACAGAACTCTGGAATAGGGGAACAAGAGATTTGTGATGACAGCCGTTCAAACAACCAG
AGGCATTTGCCTTTTTACAAAAGGTGATTAGCGTGCAGAATGAAGCTATAATTGGTGAAA
TTGCACATTATATTTCAGAAGGA


invisible?    
Gene introns: 0  

>16445 157 290     Xq12    chrX:66215500-66215344 BLAT!
AAATTGCAAGGGACTCAAAATAGCTGAAACAATCTTGAAAATAAAGAACCAGGTAAAGGA
GATTCAGACTGGCTGAATATAAACAGCACCAGTCTGCAGCTCCTAGCAATATCAACACAG
AAGGTGGGTAATTTCTGCATTTCCAACTGAGGTATCC


invisible?    
Gene introns: 0  

>17184 146 290     10p12.31    chr10:22331841-22331986 BLAT!
GAAACATACTGGGTGCATAGAAAGTCCCACACGAAACCAGTCTTTCGTTGTCCACACAAA
TAGTGCCTTAGCCTGAACTAGAAGCCCTACCTTTGTCCTTTCCTTTTCCCCTTACTTAGC
GAGGAAAAAAGCTTTGGTTATAAAGA


invisible?    
Gene introns: 0  

>22959 136 290     14q21.1    chr14:39465592-39465457 BLAT!
AGACGGCCTGTCTTGGGACTTTACCCTGTGATTGTGTGAGTCAATTCTCCTTAGTAAACT
CCCTGTCATATATACATATATACTATTAGTTCTGTCCTTCTAGAGAACCCTGAATAATAC
TCACATCATTAGTGAA


invisible?    
Gene introns: 0  

>16496 133 289     12q14.1    chr12:59688990-59688858 BLAT!
ATCTCCCCCATAAGTATATAGGCACCATGAGGGCCAGGAAAGTTTCTGTTTTGTTCACTA
CTGTATGCCCAGCAATTAGCACAACACCTAATAGGAGCACAATTACTCAGAGCACAATTA
CTCAACACCTATT


invisible?    
Gene introns: 0  

>19796 146 289     3p22.1    chr3:40705814-40705669 BLAT!
TCCTGAGGGAAAATATGGGGAATGTGAAGTGAGCAGAATGCAAGAATGAGATGACAGTAA
CAGTAGCCAAAAGAACCTCAGTAACTAGAAATTTGGGTAAATCTAACAAGAAAAGGGTCA
ATACAAGTGGATACAAAGACCCACAT


invisible?    
Gene introns: 0  

>6070 139 288     10q24.31    chr10:102812628-102812490 BLAT!
CTATGTTGCCCAGGCTGAACTCAAACTCCTGGGCTCAAGCAATCCTCCCACCTCAGCCTC
CCAAAGTGCTGGGATTACCAGCACATGCCACCACACCTGGCCTAACATTTTTGTTTTGTT
TAGAGACGGAGTTTCGCTT


invisible?    
Gene introns: 0  

>13657 129 288     11q22.3    chr11:107190548-107190420 BLAT!
CCAGGACAGACCTTACAGGCCAGGAAAGGGTGGGATGATATATTCAATGTGCTGAAGAAA
AAAACTGCCAACCAAGAATATTTCACCTGGCAAAGCTGTCCTTCAGAAACCAAAGACAGA
GAAAGATTT


invisible?    
Gene introns: 0  

>20464 125 288     14q21.2    chr14:46111650-46111526 BLAT!
GTAAAAATATTTTTTAAACCACATGACAACAATATGAATGGGGAAACAAAGGTGGCCATG
CTTTGAGGTGACTGGAACTTTAATGAAGATTCAACTCTGATTTCTGGAGCTATGAAGAAT
GGACT


invisible?    
Gene introns: 0  

>22926 118 288     6q24.3    chr6:148428697-148428814 BLAT!
CTCATAATGTGTTTCTGGTCCTTCTCCCCAACTTTATTAATCTGGGGCATGTCCCAGGAA
TCAAGATTTTTCACAAGGATTCCAATGATTCTCATGCATACTCAAGTGTGAGATCTAC


invisible?    
Gene introns: 0  

>6139 165 287     5q21.2    chr5:103597755-103597591 BLAT!
TCAAAGAATTGGTCCATTTTATCTAGGTTACCAAATTTGTGGACATAGAATCGTTTAGAC
TATTCCTTTATTATCCTTTGAATGTCCATGAGATGCATAGTGATATCTCCTCTTTGATTT
GTTATATTAGTAAACCGTGTCCTCTTTTTTCCTGACAAGAGGCTT


invisible?    
Gene introns: 0  

>13572 115 287     7p15.2    chr7:25912881-25912995 BLAT!
AATTCTACAAAATATTCTTTATTTACTCCCTAAGCAAGGACAGTAATGCTGCTTTCAAGA
GTTGAACACTTAACCATGAATTTTGATTTTTGCTTTATTTCAATAATAAACAAAA


invisible?    
Gene introns: 0  

>3367 108 286     22q13.33    chr22:51193186-51193293 BLAT!
AGACTGCAGCAACCCCTTCAGCCTCTCCACTTCAGCCAGAGTTGAAGCATTTGCTATGGC
ATTCTTGATTGCTTCTACATCCCCTGGAGATGGCCCACCTTTCTTTTT


invisible?    
Gene introns: 0  

>9764 151 286     9q31.1    chr9:107824406-107824256 BLAT!
GGGAGGCTGAGGCGGATGGGTCACTTGAGGTCAGGAGTTCGAGACCAGTCTGGCCAACGT
GGTGAAACCCTCTCTATAATAAAAATACAAAATCAGTGGACAGTAGTGGTGCACCCCTGT
AATCCCAGTCACCCAGGAGGCTGAGGCAGGA


invisible?    
Gene introns: 0  

>18219 140 286     11q12.3    chr11:61922647-61922508 BLAT!
CTTCCTAAGTAAACTAATTTGTATCTTTTAAGGAATCTGCATGGGTTCATCTAAATTGTC
AAATGTATTCCTAGAAGTTATTCGTAATAGTCTCTTATTATTGTTGTAATATCTGTAGAA
TCTGTAGTGAAGCTACCTAA


invisible?    
Gene introns: 0  

>19414 127 286     Xp22.2    chrX:9955281-9955164 BLAT!
TAGCTGAACAAAGATTCACACACCCTTCTAGGATAATTATACCTCTTTTCTCTGTCTCCT
GACTTACAGCACCCTGGCTAGAACTTCCAGAACAATCTAGCTGGGCGTGGTGGTGTACTT
TTTTTTT


invisible?    
Gene introns: 0  

>6345 168 285     1q32.1    chr1:207046639-207046806 BLAT!
AAACGGACCATTCCCTCGCTGGACTCCTAAGTTCCTGGAAGTTAGGGCTATGTTGTCTTT
TTAGCTTTTTAGCCTGCCACACCCTACCCCATCTCAGCACAGTATAATGCTACATTATTA
ATAAGGACTGAATCTGAAAGCAAGATAATGGAAAGTGTTTTTTTAAAA


invisible?    
Gene introns: 0  

>11281 141 285     6q24.1    chr6:141708820-141708680 BLAT!
AGCATGGTTTACCTAATATTTTATGCCCTCTGTGTAGACCTACTGCTCAGAAAAGAAGAT
TCCTTTCAAAATATTACTGCTCATTGACAATGCACCTGGTCACCCAAGAGCTCTGATGGA
GATGTGCAAGGAGATAGGTAT


invisible?    
Gene introns: 0  

>11711 166 285     9q21.13    chr9:75453077-75453242 BLAT!
CAAAAACTTCTGTTACCTGCATGAAAACATTTTACTATGATGTAAGAAATGGATTATCTG
TTGATAGGCTGAGTTTATTGTTTAATTAGATTATAATGCAGATGAGTAAATAAAGCTAGT
GTTTATTTCTACTTGGATCATTTTTGCACTGTGTAGTAGTAAGATT


invisible?    
Gene introns: 0  

>14976 155 285     3q13.11    chr3:102849948-102850102 BLAT!
TACATCCCAAGGACCCAAATTTTATCAGGTAGCCAACCTTACCTGCATGGAATACTAGAA
AATACAAATTTTCAACCTGAATATGTTACTCATTACAAAACTGTTAAAAAAGAAAGGCCC
ACTTGATCATGGTGGATAAGCTTTTTGATGTGCTG


invisible?    
Gene introns: 0  

>17240 173 285     1q24.1    chr1:165553240-165553412 BLAT!
ACTGCCCATGCCCTTCCCCGTGCCTGAGTTTAGCTTTACATTCAAGCCATTGATGGTAAT
TTCTCAAAATTCTACTCAATTAATAGCTACCATTTACTGAGTGACTCTGTGCCAGATACC
CTATTAGAGGTTTTATAGACACTCTAGAAACTTATATCTCAAACAACTTATGA


invisible?    
Gene introns: 0  

>14468 128 284     3q23    chr3:140605514-140605397 BLAT!
AGTATTAACTCAAAAGTCCACAGTCCAAAGTCTTATCTGAGACAAGGCAAGCCCCTTCCA
CCTATGAGCCTGTAAAATCAAAAGCAAGTTAGTTACTTCCTAGATACAATGGGGGTACCT
CGGCCGCG


invisible?    
Gene introns: 0  

>18516 156 284     22q11.21    chr22:22101151-22101299 BLAT!
CCTGGGTTCAAGTGATCCTCCTGCCTTGGCCTCCCAAAGTGCTGGACATTTGGCTTTTAT
AAGTTCTCTTTTGCTGAAAACCAAAGTAAGGTATATACAAAATGGCACTTCATCTTTAAT
TTGCGTTTCCCTGTTTACCAACAGTGGATGCTTTCC


invisible?    
Gene introns: 0  

>21071 130 284     2q36.3    chr2:230619101-230618972 BLAT!
ACCTGGGACTTAAATCCAGGACTTACTCCAGGGAGAAGAGCCTGACTCACTAAACCACAC
TGCCCTTCCATCCCCACCAGTGATGATGTTGGGGAGAGTGGGTGACCTCCCTGCTTTACA
TAACTTTTAT


invisible?    
Gene introns: 0  

>5602 120 283     4q21.23    chr4:85409640-85409759 BLAT!
ACAACTCTAAGCCAATCTCTGGAACACTGAAGTCTCAATTTCAGGAAAATACCCTATTCC
TTAGTCATCCTGCTCAAACCATCATTACTCCCAGTCAAACTTTCCATTTAATAGGCTGGG


invisible?    
Gene introns: 0  

>8971 175 283     18q12.2    chr18:33297273-33297447 BLAT!
GGTCTTTACAGAGGTAAGCAAATTAAAATGAGATCATTACGGTGAACCCTAGCCCAGTAT
GACTGATGGCCTTATTAAAAGGGGAAATGACACAGACACATAGAGAAGGAAGATGATGTG
CAGATACAGAGAAACACCATCCACAAACCAAAGGGTGTCTGAATCTACCACAACC


invisible?    
Gene introns: 0  

>17633 148 283     5q33.2    chr5:153874156-153874303 BLAT!
ATATTGCAGAAGACTTCTTGGAGGGAAAGATGGAAATAGATGATTTTCTCAGTAGCTTCA
TGGAAAAGAGAACAATTTGCCACTGTAGAAGAGCCAAGGAAGAGAAACTTCAGCAGGCGA
TAGCAATGCACAGCCAATTTCATGCTCC


invisible?    
Gene introns: 0  

>18361 131 283     8p12    chr8:33205344-33205214 BLAT!
GCATCAGGAGGTGAAGGAAAAATCAATCCTGCATCGTCTGTAAAAGAATGTATTACATTG
TAAGTTTTAGAATCCGTTTACATATTTGTCTCCTGCAGACTGAGTTCCTTGAAGGTCAGG
TGGTATCCTTT


invisible?    
Gene introns: 0  

>19000 129 283     5q34    chr5:160300902-160300774 BLAT!
CTCCGTGGGTGTAGGACCCTCCGAGCCAGGTGTGGGATATAATCTCGTGGTGCACCATTT
TTTAAGCAGGTCTGAAAAGCGCAATATTCAGGTGGGAGTGACCCAATTTTCCTGGTGCCG
TCTGTCACC


invisible?    
Gene introns: 0  

>4733 130 282     Xq26.2    chrX:132321791-132321920 BLAT!
CAAGCCTGAGCTCTCAGCTCATAGCAACGGGATTTACCCGAGTTTCTAATTAAGAAATTA
TGGAAAGAAAAAAAATGCACATACACTCAAATTTCAAGTAGCAGATTTAGGGAAAAGCAG
GAATTCTCTG


invisible?    
Gene introns: 0  

Shown 1351-1380 from 1945 sequences on 46 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs