Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1381-1410 from 1945 sequences on 47 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>6606 145 282     Xq26.3    chrX:134371726-134371870 BLAT!
TTCCCTGAACGGTGGCGAAAAGTATCTCTCTTGACTCCTGCCCCCAGCACGTGCCAGGAT
CCCTTTCTTCAATACAACCACAGTGTTCTGTTTGTGCATGCTTTGAGCCTTCAACACAGT
CCACCTTTGAAGTATGGACTATTTC


invisible?    
Gene introns: 0  

>11914 161 282     21q22.11    chr21:34757323-34757163 BLAT!
AGTCCTTCGAATTCTTCACTCTTGACAGAGAAGACAAAGGACCTGTGGTTATTATGTTAT
AACCACACAGTATCAAAGGTTACTTAGCTAAGTGTGAAAGTAACAGTAAGCGCCGCGAAC
ATCAAGGAAACTCAGGAAACTCTTCCTCGAAGCCTTTTGAT


invisible?    
Gene introns: 0  

>13482 117 282     4q21.23    chr4:85238526-85238410 BLAT!
ATTCACACGTATTTGCCCTCTGGCACCATCAGGCATTATGAGAGAGCCAGGAAACCTGGA
ACTCAGACATTATGGGAAAATAAAAGGAAGTTATTTTATGTTGTTCAATAATGTTAT


invisible?    
Gene introns: 0  

>7051 135 281     7q36.1    chr7:148334568-148334435 BLAT!
TCTTGATAGTGACTTTTGCCAGTTCTTTCTCCCGCTCCTGTTTGGCTTTCTGCTCCCGGG
ACCTTCTGTCTCCAATCACAGACATGGCCGTCTCCAGATTGGAACTCTGGATCTCCTTCT
CCTCTGCATAGTCGG


invisible?    
Gene introns: 0  

>20167 156 281     Un_gl0002250    chrUn_gl000225:127194-127349 BLAT!
GTCTTGGATCTTCCTATGGGGGCATTGTGACATATCTCTGCACTGATCACCCAGGTGAGG
TAACTGTTGTATAAGCTCTACCTACAGGGGAATTGTGAGAGATCTCGCCACTGATCACCC
AAGTGATGGAACTATTGTCTAGGCTTTGCCTACATG


invisible?    
Gene introns: 0  

>2815 117 280     12p13.32    chr12:4357819-4357935 BLAT!
TACTTGAGCCCAGGAGTTCAAGGCTGTAATAAGCTCTGATCATATCACTGCATTCTAGCC
TGAGCAACAGAGCAAGACCCCAACTCTAAAAAATAAAAATAAATAAATAAAATATAC


invisible?    
Gene introns: 0  

>10363 135 280     11q12.1    chr11:55825701-55825567 BLAT!
GTTTTCTCCTATCTCAGTAGATGGAATATACAATCGGGTTTTACACTGAGACATTCCATT
GCCCAGGGACGAGCAAGAGACAGATGCCTTCCTCTTATCTCAACTACAAAGAGGCCTTTC
TCTTTTACTAATCCT


invisible?    
Gene introns: 0  

>13079 113 280     2q36.1    chr2:222827831-222827920 BLAT!
CGCGGCCGAGGTACTCTGCGTTGATACCACTATTCCAACCAAGAAGAGCCAGGTATTCTC
TACTGCCGCTGATGGTCAAACGCAAGTGGAAATTAAAGTGTGTCAGGGTGAAA


invisible?    
Gene introns: 0  

>17108 155 280     8p23.3    chr8:1349027-1349181 BLAT!
CTCATCCTCCAGAGTCGTCTATTGAGTGCTTACTGAGCGCTCCCTCCTCATCCTCCTGAG
TCGTGTATTGAGTGCTTACTGAGCGCTCCCTCCTCGTCCTCCTGAGTCATGTATTGAGTG
CTTACTGAACGCCACCTCCTCATCGTCCAGAGTCG


invisible?    
Gene introns: 0  

>17365 150 280     Xq21.32    chrX:92713847-92713698 BLAT!
GATAATGAAAATTAAAAGGCACAGTGCAGGTAAGCGTGGCTGATTCCTGCTGATTAAGCA
ACCCCTAGCTTCCTGTTTTGTGGATAAAGGCTGCATTCGTATCCATGGCATAAATGAGGT
CTAGGGAATTCAAGGCTACTGACAGAGGGG


invisible?    
Gene introns: 0  

>21997 121 280     17p11.2    chr17:21346256-21346136 BLAT!
AATGCTATCAAACAGCATCGCATGCTACAGAGAAATCTTTAGTGAAAGGAAGGGTCGATC
AATGTGGCAAATTTCATCATTGTCTTATTTTAAGAAATTGCCACAGGCTGGGCACAGTGG
C


invisible?    
Gene introns: 0  

>11308 118 279     4q32.3    chr4:165859340-165859456 BLAT!
ATAATATCAGCAGTCAAACATAAACATGGAATCAGAACTTTTATTACAAATGCCCTCCAA
GAACACAGGAAGAAAATATAGCTACATACAAAGGGTGCTCTAAGTAGTTCATCATTGT


invisible?    
Gene introns: 0  

>11486 111 278     13q33.1    chr13:103760984-103761094 BLAT!
CCCTGAATCAGCAGTGATGAGGCAGTAGTCAGGTCTGGGGTCAGACTTGGTGATGGCCTT
GATCAGGGTTCAGAACACCACGAGTCTACGAGGGGTGAAGGATATTCTCCT


invisible?    
Gene introns: 0  

>13224 139 277     18q22.3    chr18:69836861-69836723 BLAT!
GTCAAAATAAGAAATATATAAAAATTTTTACTGGTGCCAAAAAGGTCTTTCTGACAAAGT
AATCCACTAACATGTGAATTGAGGAATACTTTCTTAGCAAGCTGGGAGTGCAGGCCAAAG
TGCAGAAGGCTTAATGTTG


invisible?    
Gene introns: 0  

>15010 152 277     8p11.22    chr8:38396813-38396662 BLAT!
AGATTGCGCCACTGCACTACAGCCTGGGAGACAGAGCAAGACTCTTTCTCCAAAAAAGAA
GAAATCTTGTCATTTTCAACAACATGGATGAAACTGGAAGACAACATGTTAAGTGAAATA
AGCCGGGCACAGAAAGACAAATACCACATGTT


invisible?    
Gene introns: 0  

>18748 128 277     6p24.3    chr6:10021958-10022085 BLAT!
TTTAGAAGAGAAGGGATTTCACCATGTTGATCAGGCTGACCTCGAACTCCTGATCTCAAG
TGATCCATCCGCCTCAGCCTCCCAAACTTCTCACTCATCTTTAATCAAACACCAATTCCT
ACCACTTT


invisible?    
Gene introns: 0  

>2704 107 276     17q21.2    chr17:38782940-38783046 BLAT!
ATGGTGAAACCCCATCTCTACTAAAAAATACAAAAATTAACCGGGCATGGTGGCGAGAGC
CTGTAATCCCAGCTGCTCTAGAGGCTGAGGCAGAGAGAATTGCTTGA


invisible?    
Gene introns: 0  

>5751 141 276     6p24.2    chr6:11145953-11145813 BLAT!
TATGCTCATATAAATTAGGGTTTCATCTTGTGTTTGCATTTGAATATGCGTTCATTTTCC
TTTGTGCTGAATGACATACAGTGATTTGAATGCTTTAAGTATCTCCCCTTCTCTAAGCAA
CAAGGCAGAAGCCCAGGGTTT


invisible?    
Gene introns: 0  

>9307 165 276     5p13.1    chr5:39086085-39086249 BLAT!
TAGTCACGGGAAAGAACCTAGACCCTTACAGGCCCTGAAACTAGCATGGGGAGCTACTTG
GAGACGGCATAATGGCACTGCTCCAGGGAAGGAATTGTGCTGGGTCCCACATTCCCCCTG
AGTCATAGACAGCTACAGTAAGGCACCATTTTGAAAGCCCAGCCC


invisible?    
Gene introns: 0  

>12358 132 276     8q24.22    chr8:132425159-132425028 BLAT!
TATTTTCCTATATTCAACTAAAATCTGCTTTCTGATAACTTCCATCCTAGCTTTTAATTA
AGCAACACTAAGAAAATCTCTATCCCCTTCCACATGGTATCACTTTATATATTTGAAATT
AACCATGAAGAA


invisible?    
Gene introns: 0  

>14843 138 276     18q22.3    chr18:69259722-69259585 BLAT!
AGGTGCCCACGACCACGCCCGGTTATTTTTTTGTGTATTTTTAGTAGAGACAGGGTTTCA
CCGTGTTAACCAGGACGGTCTTGATCTCCTGACCTCGTGATCCGCCCGTTTTGGCCTCCC
AAAGTGCTGGGATTACAG


invisible?    
Gene introns: 0  

>15372 145 276     20p12.1    chr20:16044293-16044437 BLAT!
AGAATAAAAAACAGAGGTGCAGGAAAAAGACCTGGGGAGGGACCAAACCCGAGATGAATC
CAGGTTCTGTCGACCGTTACTCTCTTCTCCAGCCTCTACCACAGTTTTCACATGACCCTA
AAGGGTAATTTGCTAAGTATAATGG


invisible?    
Gene introns: 0  

>15618 130 276     16q21    chr16:57748721-57748602 BLAT!
CCACCAGCAAGACCACAGTTGTTGACAGCCATAAGATTGGAGACAAGCACAAAGGGATAG
GTCAACATACTCGCAAAAAATCCTGTGACAGCTTGAGAATAACTCTTCATTTCATTCATG
GTAGAAACCC


invisible?    
Gene introns: CCDC135 (57728712 - 57765367)  

>16069 128 276     3p13    chr3:70257291-70257418 BLAT!
GCCCAGGAACAACTTAAAACCTGAACAAGCAACAGTCCTCGTGGTTTGGTGGCACAACTG
GGACGTGGTCAAGAGGTGTCCTTGGGAATTGCATTCCCATTGTTAACGCAATGCCTGGTT
GGTTCAAT


invisible?    
Gene introns: 0  

>10358 137 275     15q22.2    chr15:60013568-60013432 BLAT!
CCTGTAATCCTAGCACTTTGGGAGGTCAAGGCAGGAAGATTGCTTGAGTCTAGGAGTTTG
AGACCAGCCTGGACAACATAGCAAGACCCCGTCCCTATAAAAAACAATTTTTAAATAGTC
AAGTGTGGTGGCTAGGA


invisible?    
Gene introns: 0  

>10571 160 273     7q21.3    chr7:97270947-97271106 BLAT!
GGCTCATTACAGAGAAAGATGCCAACTTCTCTAGCTCAAGAACATTCCAAGCAAAGTAGC
TAAGAAAAAAACAAAAAACAAAAACTGTCTTCAGAGAACACTACTGAATTTTGTGGTAAG
CACATTAGCTGTTCTAAGAATTTGCTTTTCCTGTCCGCAT


invisible?    
Gene introns: 0  

>12250 124 273     6q21    chr6:110238535-110238658 BLAT!
TCAGGCCCTCCCAGCCTTCCCCTCTAATGCCCTCCTCAGAAATGGCTCTCTAGGAACTAA
CAGTTTCCCAAAGCTTGACGCATCTGCCTGGTGGAAAGGTTCTCCTGCTTCTCCTCCTTC
TGAT


invisible?    
Gene introns: 0  

>9473 145 272     3q26.1    chr3:163968345-163968489 BLAT!
GGTTAGAATAGAGATGTCAAGACCAAAAGAATCAACTTCAAGTCTCAAAATGCAAAACAA
TTGACAATTGATCATCATATCCAAAAAGGCTTCCACATAGTTTCTTCATGTTTAAGTCTC
TTCTATTTTATCTCCAACTTCCATT


invisible?    
Gene introns: 0  

>13402 113 272     9p13.2    chr9:36809462-36809350 BLAT!
AAAGTTCAATGTGGAAACTCTGGAGTCACACACAGACCTGGGTTAGTGTCTCCACCACCA
ACAAGCTGGGGAACTTTGGATTAGCAAACCATTCTCAGCTTAATTTTCCCATC


invisible?    
Gene introns: 0  

>6140 133 271     9q33.1    chr9:121011509-121011641 BLAT!
CTGCCTGAGTTCCCACAAGTCTTCTTGTTTGATCACATATCCCTGCTGCTTCTTCTCACT
GACTTTGTATCTCTTCAGCCTGCCTTTTATTCTCACTTGAATGACCTTGAATACAACTTC
TGGCCCTGCTAAC


invisible?    
Gene introns: 0  

Shown 1381-1410 from 1945 sequences on 47 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs