Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1441-1470 from 1945 sequences on 49 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>20756 123 265     18q12.2    chr18:32976179-32976057 BLAT!
AACTTTCCTTTTAGAGAACTAACAGGGTAAGGGGGACAGATACCACACACAGGAGTCAGA
GGAAACCTTCCTTGAAGTGGGGGTGAATTATAATGCTTTTGTGCAAAATTACAGGCCACT
TTT


invisible?    
Gene introns: 0  

>12824 122 264     2q24.3    chr2:164434197-164434284 BLAT!
CAAAAGGTAGACTGGCCTAGCCTCCCAGCCTACATCTGGGTGGACATCATCTAATCAACT
GCCAACACAGCTAGGATAAAAGCAGGCAGCAGAACGAGGAAGGACCAGACTGGCTGAGTC
TC


invisible?    
Gene introns: 0  

>17463 133 264     5q13.3    chr5:75672716-75672590 BLAT!
CCCCTGCAGGAGGAGGAGCAGAGAATGGAGTAGGAGGTATCTTTCCTTGTTGAAATGCAG
CCGTTGTTTTGTCAATCAGGCTCTGAGCCTGCTCTTCCATCCATTTCTGATAATAGTCTT
TCACATTCTCTTT


invisible?    
Gene introns: 0  

>21072 129 264     12q24.23    chr12:118145742-118145614 BLAT!
CAGCATCTCTTGGATCCAGTATGGTAAGGATCACCCTAGGGGAAATACTACCAGAGATCA
TTGATCCAGGAAGCCTTAGAGAGCAAGCTTAGGCATATTTGCAACCCCTATCCCCTCCCA
GACAGCCAC


invisible?    
Gene introns: KSR2 (117890816 - 118406028)  

>3296 116 263     9p12    chr9:41211144-41211259 BLAT!
TAGTTTTGCAATGTGGAGCCCGACGCCTAGGTAACATTAGGTTCCTACCCTCCCATGAAA
ATGTCAATAAAAAGAGTCCAACTTTGTAACACATTTGTAGAAATTTATTCTGAGCC


invisible?    
Gene introns: 0  

>6379 126 263     1q32.1    chr1:200520569-200520694 BLAT!
TGAAGAGTAAAATAAACAAAGAAAATCAGTAAAATAAAAAAGCATAGACCACGAAGCAAT
TCTAATGCTGAAAAGATTTATTAAAGGCATTCTCTTTATAACATTTCTTGTCAGTGCACA
TAATTC


invisible?    
Gene introns: KIF14 (200520624 - 200589862)  

>8213 108 263     Xq21.32    chrX:92478571-92478677 BLAT!
AGCTGCACCTGGGTGCTTTCATCGTGAAAACCCTCCAGGAAGCTTTCTAGTAACTCATCT
GCATTGTCAATTCTTTCAGCATATTCTCCCACAATCCAAATCATAGCT


invisible?    
Gene introns: 0  

>9059 133 263     13q21.1    chr13:55821291-55821159 BLAT!
TTAAGGTCCTCTATGCCTTTTAATTGAATAATTTATCCCATTTACAATCAAGATTAATAT
TAATAGGTAAGGACTTACTAATGACATTTTGCTGTTTGTTTTCTGGTTGTTTTGTAACTC
CTTCTTTCTGTGT


invisible?    
Gene introns: 0  

>16471 109 263     Xp22.33    chrX:3982016-3982117 BLAT!
AGAAGAAAGACATTTATTTAAACAAGTAAATTCAGGTCGATGTTTCTACATTTTCAGCCA
TAAGTTTGGCAGTTTGGAATCATCAATGTGATGTTGTGTTTTTTTAAAA


invisible?    
Gene introns: 0  

>18925 139 263     7q21.12    chr7:88078723-88078861 BLAT!
TAATGGCCTGCATTTGCATATCAAAGTTTGCCTACCTGGCTCTCAACATATCTCCCCACA
TATCTCCACATGTGTAGAACATCCAGGGCACCCTGCATTTGCATATTAAAAGGCTACAGT
GGGAGAGCCAGCTTTTTTG


invisible?    
Gene introns: 0  

>18939 164 263     13q33.1    chr13:103928409-103928572 BLAT!
CAGCATACCTGGAAGGAGCAGAGAAGTAAGACAGAGCCAAGTGCATATTCTTTTTGTGTA
AATGTGCACCTTTAATGGAGCAATTGGGTTTTGAGAAATTAAAATAGCAAATTTTCTATT
ATGAAGACAGGGATTTTGCTTTTTAAAGTTATGTCTGTATCTGC


invisible?    
Gene introns: 0  

>20929 135 263     11q11    chr11:55536537-55536403 BLAT!
CCAGGACATGAATGAAGCTGGAGGCCATCATTCTCAGCAAACTAACGCAAGAACAGAAAA
CCAAACACTGCACGTCTTCACTCATAACTGGGAGTTGAACAATGAGAACACATGGACACA
GAGAGAGGGACATAA


invisible?    
Gene introns: 0  

>10090 107 262     10q24.1    chr10:98749783-98749889 BLAT!
AGTATAAAATTGATCTGTGTAAGGCGGTCTTCATATCCTAGCAGTAAGTGCTATTCCCCA
TGCTTGCTCTCAAATCCTTTTCAGGGGAAAAATAAAAAGATTATTGT


invisible?    
Gene introns: 0  

>12829 136 262     16q21    chr16:62624563-62624698 BLAT!
CAAACAGTCTACTATACAAGAATCACATAAGTTGTCATTCTTGGCCTTCAGAATGGCCAC
ATAGGAAGATTTCCTAATTCACAATGAAAATAATTTAAGACATGCTAAAGTATAGAAATG
TAAAGAAAAGAGAAGG


invisible?    
Gene introns: 0  

>14049 136 262     6q15    chr6:93051511-93051376 BLAT!
AGGAAACTGAGGCTGAGTAAATAGAGTCTAGTTTCTGGACTCAGAGTTCATAAATTTTCT
GCTTTAACTTCATTTTTATAATTCAAAATGACTCTTCCTCAATCAGTATTTTGAATATTA
TAACACTATAGTTATA


invisible?    
Gene introns: 0  

>14071 129 262     18q22.1    chr18:63039559-63039687 BLAT!
GGGAGCAGATGTGTCACATGGTGAGAGAGAGTAAGAGGGAGAGGAGAGGGTGCCAGGCTC
CTTTTAACAGCCGGCTCTTGAGTGAACTAATATAGTGAGAAGTCACTCATCACCAGGAGG
ATGGCACCA


invisible?    
Gene introns: 0  

>21415 117 262     4q13.2    chr4:67672395-67672511 BLAT!
AATATAAAAGACTGGTGATAAGGTAAATGTTAAACAATGTATTTCCCTGGAAACAAGATT
TCTATATTCTGCAAGGTATCAGCAATCAATCAATTAAAATTCACTAACACAAATGAA


invisible?    
Gene introns: 0  

>5815 156 261     9p22.2    chr9:18270531-18270376 BLAT!
TTCATTCCATTCAATTATTATCATTTTATAAAGACCTTATCAAAGATTCAGCTTCTCAGC
AAAGGCTTTTTGGATTTAGGTAAGGATACAAAGATAATTTGGCCTTTGCAGATTTTAGGA
TTCCAGCTGAATTATCCCATTAGAAGTCTCCTATGG


invisible?    
Gene introns: 0  

>6681 136 261     12p13.2    chr12:10737061-10737196 BLAT!
TAGATAATAAAGGAGTATTATTGTTATGGGTTGAACTATGTCCTCCAAAAATGTATGTTC
AAATCATAACCCCCATACTTGTGAACGTGACCTTATTTGGTAACAGGGTTGTTTTGCAGA
TGTAATCATGTTAACA


invisible?    
Gene introns: 0  

>15146 110 261     5q34    chr5:160344797-160344886 BLAT!
CGCGGCCGAGGTACGCGGGGCCCTCCCTTCCAGGTTTGCTGTCATGGTCCTTTGCTGCCT
CAGCAGTTGTTAGCTGCAGCTGGCTGAGTGTTCCAAGGAGCAAGCTTTCG


invisible?    
Gene introns: 0  

>19760 125 261     12p13.31    chr12:5924470-5924594 BLAT!
GAGGGAGGTTACCAGAGTCAAGAATTCAAGAAATCAGAGCAGTGTGGGGCAAACAATCCT
AATAATGCTTTGATAATTCTTGAGAGAACATGAAAATCATTATGTTCTTAACGATGATCT
TGAAT


invisible?    
Gene introns: ANO2 (5671816 - 6055398)  

>20623 121 261     3q13.13    chr3:110253688-110253808 BLAT!
GAATTAACCAAAGAAGTGAAGTATGTCTGTAGTGAAAACTGTGAAACACTGATGAAAGAA
ATCGAAGAGGACATAAAACACATGGAAGAATACTTCATGTTGATGTATTGGAAGAATCAG
T


invisible?    
Gene introns: 0  

>21981 112 261     11q23.3    chr11:118000850-118000961 BLAT!
TAGTTTTTAAGTATTTCAGTCCAAGCATGGTGGCTCATGCCTGTAATCCCAGCAGTTTGG
GAGGCCAAAGCGAGCAGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGC


invisible?    
Gene introns: 0  

>3814 133 260     18q12.2    chr18:35526025-35525893 BLAT!
CTGTAGAAAGAGAAAGTCTTAATGATGCTGCTGGTTTTCATGTGTGATGAAATTGCCTCT
TCCTTTTTAGCAGGTCAAGTATCACCTTTGGGGTTTTTATCCAGCTCTGGGGATGGGTGT
GCACTGGATACTT


invisible?    
Gene introns: 0  

>11048 142 260     2q14.1    chr2:117949095-117948954 BLAT!
CTTCAGTCCTGATGGATTTATTTTGCCTCTTTCATTTTCTTATTCTGAATTCACAGTATA
GCAGTTTCCACAATGGATTGCATAGTCCTCTCAGCATTTTTGGACTCCGGTTCCATGAAC
ACTTCATTATGGATGTCTGCTG


invisible?    
Gene introns: 0  

>15257 134 260     3p25.3    chr3:10891055-10891188 BLAT!
CATCAACTGAATCCATCTTGCCCATCCCTGTCACCAGCTCCTTCTCCTGGTCTCCTGGGC
CTGAAACCACTCAGCCATGTTGGATACCTCTCATCCAATTATTGACCAAGTCTGTTTTTG
TTTAAAAAGAAAAA


invisible?    
Gene introns: SLC6A11 (10857916 - 10980146)  

>20101 153 260     20q13.32    chr20:57645353-57645201 BLAT!
ACAGGATTTTTTTGGTAATAAATGAATTCTGAGTCCAAAACCCTGGTAAGTAACTTTTGG
AGATAAAGACTTTTTATGTTTGGGGACTCCCAACATTCCAGCTCCTTCATTTATTTCTAT
ATTGCTGGGATTCTCACTATCATTAATTCAATC


invisible?    
Gene introns: 0  

>7562 128 259     11q12.1    chr11:57727221-57727348 BLAT!
AGTTCAGTGATCCATGTGTGGAAGCCTCCTAGGCTGTTACCATTGATCCCTCCTTTATGA
GGCCATCCGACCCATGTGTGCAGAATTTCTTTGAGCTAGAGAGAACGCAGGCTGGCAATT
CTTTTCTT


invisible?    
Gene introns: 0  

>10161 158 259     1p21.2    chr1:102050754-102050597 BLAT!
CAACATGCCAGGCTAATTTTTGTATTCTTTTTGTAGAGACAGGGTTTCACCATGTTTCCC
AGTCTGGTCTAGAACTCCTGGGCTAAAGCCATCTACCCACCTCGGCCTCCCGAAGTGCTA
GGATTACAAGCATAGGCCATGATGCCCAGTCATGAAGG


invisible?    
Gene introns: 0  

>11195 110 259     13q33.2    chr13:106811125-106811016 BLAT!
CAGGCTGGAATGCAGTGGCGTGATCTCGGCTCACTGCAAGCCCCGCCTCCCAGGTTTAAG
CAATTCTCCTGCCTCAGACTCCCGAATAGGTGGGACTACAGGCGCCCACC


invisible?    
Gene introns: 0  

Shown 1441-1470 from 1945 sequences on 49 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs