Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1471-1500 from 1945 sequences on 50 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11211 130 259     16q12.1    chr16:51842087-51841958 BLAT!
AGGAACATGTTATTGGAAACTGGAGAAAAGGCAATCATTATAAAGTGACAAATAACTTGA
CTGAATTGTGTTCTAAAGTTTTGTGGAAAGCAGAACTTGTGAGCAATGAAATTGGATATT
TAGCTGAGGA


invisible?    
Gene introns: 0  

>17528 114 259     3q12.3    chr3:102426132-102426245 BLAT!
TGGGCATGCTTGTGTGGGGAAATATGGGCTTGTGTGGAAAAGATATATCACAGATGAAGA
GGGCTGGGAGGGTCTTTTTTTCCTTGGATATGTTAAATAAACTGTGTGTATTGC


invisible?    
Gene introns: 0  

>5248 141 258     8q23.1    chr8:110087652-110087792 BLAT!
TGCTTATCCTTCTCTTTTAGTATATTCATTTTGCTAGAGTTTGGTAAAAACTCATTTTGC
TACAGAATGGGCATAGAGACTATAAAATTTCAGTGAGAAAGAGACAATAAGAGTGGGTGC
TTTCATCTCCCTGACTTATTT


invisible?    
Gene introns: 0  

>5835 118 258     18q12.1    chr18:29543174-29543291 BLAT!
CGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCAT
CATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACCCGGAACTT


invisible?    
Gene introns: 0  

>11691 127 258     16q24.1    chr16:84252157-84252031 BLAT!
CTGTTGGCTGAAAGGTCCCTTATGTTACCCAGAAGCTCTTGTTTTCTCTGAGGCCAGTGG
GCATGACTATAGCCAAAGGTGGACATCTTCCAGCTGAAGGCAAAGAGAAAACGGCCCTTT
ACGGCGA


invisible?    
Gene introns: 0  

>19418 113 258     6q12    chr6:66013984-66014068 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGCAGGAAGGAAATGAAGTTGATTCTCAGAGCAG
TATTAGAACAGAAGCTAAAGAGGCTTCAGGTGAGACCACAGGAGTTGACATCA


invisible?    
Gene introns: EYS (64429875 - 66417118)  

>9412 116 257     2q12.1    chr2:105221639-105221524 BLAT!
CCCATGTAGCTGGGATTACAGGCCCCTGCCACCATGCCAAGCTAATTTTTCAATTTTAGT
AGAGACGAGGTTTCACCATGTTGGTCAGGATGGTCTCAAACTCCTGACCTCAAATG


invisible?    
Gene introns: 0  

>15829 104 257     1p21.1    chr1:103753433-103753536 BLAT!
ATATTGATTCTTCCTATCCATGAGCATGGAATGTTCTTCCATTTGTTTGTATCCTCTTTT
ATTTCCTTGATCAGTGGTTTGTAGTTCTCCTTGAAGAGGTCCTT


invisible?    
Gene introns: 0  

>17775 146 257     4p14    chr4:36902234-36902379 BLAT!
TGCAATTCTCTCAGCCTTCTTGCCCTTGCCCCACATGTTTCTGGCAACATGGCCACCCAC
ACATATCCCCACGTGTGCAGAACATCATGGTGTCCTGCATTTGCATATTAAAATGCTAGG
GTAGGAGGGACAGCTTTTTCACGGCT


invisible?    
Gene introns: 0  

>19565 118 257     5p13.1    chr5:40633075-40633192 BLAT!
GAAGTCATTATATGAAAAAGACACTTGCACACACATGTTTATAGCAGCACAATTCGCAAC
TGCAAAAATATGGAACCAGCTTAAATCCCTGTCAACCAGGTGGATAAAGAAAATGTGG


invisible?    
Gene introns: 0  

>21736 101 257     4p14    chr4:40741366-40741466 BLAT!
AAAGTATGTTTACTTAAGAGAGATCTGATCCATTCTTACAAAGCTTTGGAACACTTACAA
TAAATAATTTGTAATAGAGTTCATAATAGTGGAGACATTAT


invisible?    
Gene introns: 0  

>4086 124 256     20p12.1    chr20:12894677-12894800 BLAT!
TCTCTAACTCTCAATTCTTCCCTACTTTTAACATTATGACTTTTCAATAGATGCTGTGTC
CCTAAGCACCTCTACTCTCTCCTTTTTGTTATGAATAATTCAAATAGCACAGAGCAAATC
AATA


invisible?    
Gene introns: 0  

>10303 126 256     4p11    chr4:49637276-49637216 BLAT!
CATTCCATTCCATTCCAATCTGGTTTATTCCATTCCATTCCATTTCGATCCATTCTATTC
TATTACATTCCATTGCATTCCATTCCCTTCCATTCCAATCAGGTTGATTCCATTCCATTC
CATTCC


invisible?    
Gene introns: 0  

>17986 156 256     4q22.1    chr4:91480466-91480311 BLAT!
GATCCCCAAATTACTCCTAAGAAATTTCCTATGTGCCATTTACTATCTCAGGAATTAGAA
CCTATAAAAAAAGTAGGGAGCAATTAATAAAAGGGGGGCAGCTAAATTTGGACAACACTC
AATTTAATTTCATGATTTTGCCTCAAAATGTTCAAC


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>3982 144 255     13q12.12    chr13:23430096-23429953 BLAT!
GTGTTCATAAGTGGTTGTAAATCCTTCTCTTGCATCATACTTGCTAAGCACCCACTGGCC
AAATCTAATCACATGGCCAAGACCAGAGTCAATGTGGGTAGGGATACACATGGCAAAATA
CCAGGAGGCATGCTTCATTAAGGA


invisible?    
Gene introns: 0  

>6762 156 255     5p15.1    chr5:16309774-16309929 BLAT!
ATCTTGGAATGGAACCAGACAAAGGAAACCTACCTGGAGTGCTGTAAAGGAAGAAATTTA
ATTATTATAAAGCTGGAGAGATTTCAATTGGGCATAAGGAGAAATTCATCATCATTGCTA
TAATACAATATGGGAATAGGCCAATCAGAGCTCATG


invisible?    
Gene introns: 0  

>7763 108 254     5q21.2    chr5:103552898-103553005 BLAT!
CTGAAACATTCTATACTTTTATGCACCACTTAGTGTGTAGTCATTTCCTGCTTTGTTCTT
TTGTTGCACTATTTAAAATGCTTTATCTCTCATTTTTTAGTTCATACA


invisible?    
Gene introns: 0  

>3822 107 253     2q32.1    chr2:184818748-184818642 BLAT!
GGATTTTAAAAAATGCGCTTAACAGTCAAATGCAATAGCTACCTTGTGATCCTTGGGACA
GTCATTGGAATGTGAAATCTGCTTTGTTATGCCAAAATAATTTTTTT


invisible?    
Gene introns: 0  

>6566 136 253     6p25.3    chr6:1065917-1065788 BLAT!
TGAGATGGAGGCTTGCTCTGTCACCCAGGCTAGAGTGCAGTGGCATGATCTCGGCTCACT
GCAATTTCCACTTCCCTGGTTCAAGGATTCTCCTGCCTCAGCCGTCTGAGTAGCTGGAAT
TACAGGCAGCCTCCAC


invisible?    
Gene introns: LOC285768 (961240 - 1101567)  

>10817 121 253     4q28.3    chr4:131444604-131444485 BLAT!
GATTTTTGAGATAATGCTGAAATGAGTTAAGACTTTGGGATACTGTTGGGAAGGCATAAT
TGGTTTTGAAATGTGAGACATGAGATTTGAGAGGGGCCAGAGGTGGAGTGATATGGTTTG
T


invisible?    
Gene introns: 0  

>14497 147 253     3q24    chr3:146434542-146434688 BLAT!
AAAATAAAAATAAAAATAAAGGCCTTCTTTTATGCTGTCAGGTTCTTGGATATTTCCAGA
AGAGTAGCATGTCCCTAAGGACACTTTGGATCTCTGGGACCATTCCAAGACAAGCAAAGA
ACGGTAAGGGCATTGGTAAACATAAAG


invisible?    
Gene introns: 0  

>16712 130 253     2q36.3    chr2:227256836-227256965 BLAT!
CTTTTCCCTCTTCCTCTCTCTAAATACAGCCTAAAGCCCTAGACATTATATATTAAGTAA
ACATAAAAAGACATTAAGAGGTGGAGAGTAGAAAACAAGCTGGCTAAAGACCCAAGGGAC
AGAATGGCGG


invisible?    
Gene introns: 0  

>22011 139 253     17q22    chr17:50838779-50838641 BLAT!
TTTAACATACTTTACGCTTATTCATTGAGCATTATCAAACATTGCTAATGAAATCATTCA
CCTGAAGAAGTGGTTGCATGAAACTCTCCTGCCTTGTGCCACAGATGAGATCCTTTCAAG
TTTCTGTTGGGCATTCCTT


invisible?    
Gene introns: 0  

>15420 120 252     4q12    chr4:59498831-59498712 BLAT!
GTTCTGTGTGATAATCTGCATTAATTCATTAACATTTATGTAGTTTGAGACATTCTTCAC
AGTGCAACTTGCTACTTAATCAGTTAAACAAATAGTAAAAGTTTTCTTTTAATGAATCTG


invisible?    
Gene introns: 0  

>18654 154 252     14q21.2    chr14:45030977-45031130 BLAT!
CACCCACCTTATAGGATTTTAATAGGATTAAACAAACAAAAAAAAACAAGTATACACTCC
TCAAAAACCACTAGCAATTATTAGTATTAAAAAGTTTTCCCAAGATATAAGAGAAAGAAG
GGCTAAACTAAAGCAAATAAAAATTTAAAAACTG


invisible?    
Gene introns: 0  

>20693 150 252     14q23.2    chr14:63316743-63316594 BLAT!
TAATGTTTTCTGAGTGAATACCAGGTGTCAGGCAGTCTTCTCAGAGTTCAACATGTATTT
ACCCCTTCAAGTTTATAAGGATGTCTCTGTCAAATTATTCATTGATTTAGCAAATATTTG
TATTTTTTTCACATGAGATATTTGTTTTAT


invisible?    
Gene introns: KCNH5 (63173944 - 63511955)  

>7929 112 251     13q21.33    chr13:72733582-72733471 BLAT!
AGGGATTAATTTTTATTGGGAGAACCCGAGGAAGCCTTTTGGAGAGGGTGAATTTGGCTG
AAGACATAAGAAAGAATGTTTTCTGACATGGTGAAAAGAAGTAGGCCTAGAT


invisible?    
Gene introns: 0  

>17948 103 251     17q24.3    chr17:69259448-69259550 BLAT!
GAATTGTGTTCCATCATTAAATATCCTCATTCTCTACACGAATAAACATGTCAGTGATAT
TATCTTCTTGTGTGAAATGTCAAACCCTTAAATGTATATGTTT


invisible?    
Gene introns: 0  

>18449 123 251     7p12.2    chr7:49079452-49079330 BLAT!
CTGTGTTCACTCAAGGCCCTGGAGCTCTGAAATCAGCAGGTGGCAAAGCCAGCCAAGCCT
GTGTCTTTCCCTTCAGGGTGCAAGGTCCCCCGGTCTCTGGGTTGGTAGGGAGTCAGGGAC
TAG


invisible?    
Gene introns: 0  

>4409 116 250     1q31.2    chr1:191160624-191160509 BLAT!
ACTAAACCATATCTAGATGGTAAATTGATATCTATATTGAATATTACAAGATAAAATAAT
CCATTATATTTTTATGATATCCTTATGTGCATCTTAAAACTGTCCTTTGACATTTG


invisible?    
Gene introns: 0  

Shown 1471-1500 from 1945 sequences on 50 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs