Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1501-1530 from 1945 sequences on 51 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>7423 101 250     12p13.33    chr12:70624-70524 BLAT!
AGTGAATACACAAATGGTGATATGGACATACAGTGGAGTATTAGTCATAAAAAGGAAGGC
AGAGCTGATCCATGGCACCATGTGACTGAACCTCAAAAGCA


invisible?    
Gene introns: 0  

>8067 107 250     16q12.2    chr16:53290564-53290669 BLAT!
CTTTTTTTTTTCCAAATCAAGACATGATAAACTTACCTCTTCCATTCATCTGAATAGTTT
ATTATTGGAGTATTCTGTCTCACCTGCACTAATTGCAGAAAACTACA


invisible?    
Gene introns: CHD9 (53088944 - 53361414)  

>8281 103 250     4q32.1    chr4:156770116-156770218 BLAT!
GCCTGATTTCTCCAGAATTTGGAAACTATTTGTGGGTATTCTTAACTTGTGGCAATACAG
TTATTTGCATAAGTGCAATAAGAATCTGTTTTCACTTGTAACA


invisible?    
Gene introns: ACCN5 (156750880 - 156787425)  

>9170 127 250     1p21.1    chr1:106435377-106435473 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGGACACACAATGGGTGATCCATTCATGTTGCA
GCAGTCTACAAATCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCATTTCATCTTGG
GGGACCA


invisible?    
Gene introns: 0  

>13093 147 250     12p11.21    chr12:31533849-31533983 BLAT!
AGTCTCGGTTCGCTGCAACCTCCGCCTCCCAGGTTCAAGCAATTCTTCTGCCTCAACCTC
CCGAGTAGCTGGGATTACAGGTGCATGCCACCACGCCTGGCTAATTTTTGTATTTTTAGT
AAAGACGTTTTCACCATGTTGGCCAGG


invisible?    
Gene introns: 0  

>17598 160 250     21q21.1    chr21:18520240-18520104 BLAT!
CGCCATGCTTTCGATCCCCCCGCGTACTATTCTAGGATAGGTTTTTTAATTCCTTCAGCT
CTTTAACTATGTCATACCACTCTCTCCCAGCATGTAAAGTTTCCACTGAAAAGCCTGCTG
GTAGATTTATTGGATCTCCTTTGTATGTTGTTTCTTTTAT


invisible?    
Gene introns: 0  

>18308 146 250     3q27.2    chr3:185968594-185968731 BLAT!
CTCCCAAAGTGCTGGGATTGCAGGCGTGAGCTACCGTGCCTGACCAATTCTGTCATTCTT
AAAAAAAGTAAATACTAGTGTCTTTGTTGCACCCCCACCCCCTCCCAACCCCCAGCTTCA
TTTATAGAAATGATTGATTTGTCCCC


invisible?    
Gene introns: DGKG (185864989 - 186080023)  

>19181 106 250     9q31.1    chr9:107609934-107609829 BLAT!
TGATGATAGCTCTAGCTCTCTGCCTAGCAGAGGAAGGACATTTCAATAGAAGAAAAAGTT
TAAGACCTTGCCGAGAAACAGAGAAAGGATGTTTGTCTTTTTAAGA


invisible?    
Gene introns: ABCA1 (107543283 - 107690527)  

>21219 114 250     2q14.3    chr2:123144251-123144364 BLAT!
TGGGGATGATATTGCAAGAGCAGCAATGGCTGAAATTTACTGAACTCTTAATGTGTGCCA
GGCATGTTATATGGATTTGTGGATTTAATCCTTACTATGACCTGAGTGGTAGTT


invisible?    
Gene introns: 0  

>22800 159 250     3q13.11    chr3:103738463-103738305 BLAT!
TTTTGCATTGATTCTTTCTCAACTTGGTAGGCTTATCTGCCTTTGATCTTCGAGATTGCT
GACCTTTAAATGAGTTTTTGTGTTTTTTGTTTGTTTGTTAATATTATTGTTATTTTCTGT
TTGTTTTTTTCTCTTTTAACAATCAGGCCAGTCTTCCGT


invisible?    
Gene introns: 0  

>15793 129 249     19q13.11    chr19:35241188-35241303 BLAT!
AGAGAAGCAACTCCTCTCATATAGGGGATCCTCAAGACTATTAGCCAGTGTCTCATCAGA
AACCTTGGAAGCTAGAAGGAAGTGGGTCAATAAACGTAAAGGGTGAAGAAAAAAAGTACC
TCGGCCGCG


invisible?    
Gene introns: 0  

>19630 133 249     11q24.3    chr11:129773807-129773939 BLAT!
AGGGGGAGAGAAATAACTTTGGCTAAAACCATTCTCAAATGAGTTCCAGGCCAGAAAAAG
GTCAAAGTCAATGGGTCCTACAGGGAACAAAAAATGTCCTGATCATGCCAATATGATTAT
CTCATTTTACATT


invisible?    
Gene introns: PRDM10 (129769600 - 129872730)  

>10256 114 248     19q12    chr19:29308346-29308459 BLAT!
GCCCTGGAGAGGCTCACATTCACTTAGAAAAAAATACAATAGTGAGCATACTTTTAAAAT
GCTCTTTTTATAAGACTCAACATATACTCAGAAAAATTCCAGTTGGGATCTGTG


invisible?    
Gene introns: 0  

>20341 163 248     3p25.1    chr3:14132622-14132460 BLAT!
ACTGTTTCCATGTGCTTAAGAATGGAGAGAAAAGAAATTTTGGAATGTGGTCCTGCTAAT
AATTGATAAGTTGACTCTACTCATTTAGACTAGGGTTTTCTGGCATGAGTTTTAACTACA
TAACTATCTTCAGGGATTCAGAGAAAAGACTTTAAATCCCATC


invisible?    
Gene introns: 0  

>21084 123 248     20p12.1    chr20:16042899-16042777 BLAT!
AAAATCCCAGCTTTTTACCCATGACCTCCTGAATGAGAAACTCTAGGTTGGGGTCCAGGA
TCTGTGATTGATCAAGGCCTCTAGGTGATTCTGATGCTGACCCAAGTTTGAGAGCCTTTA
GTA


invisible?    
Gene introns: 0  

>6447 158 247     8p12    chr8:30778772-30778901 BLAT!
AGCGTGGCGCGGCCGAGGTACGCGGGGGTGTCTGAACTGGAAATAAAACATGCCAGGAAC
AATGTCTCCCTTTTGCAGAGCTGTATTGACTTGTTCAAGAATAACTGATATGCCTTCACT
CAGAAGAAAAGAAATGAATGTGAAAGAAAGCCAAGCAT


invisible?    
Gene introns: 0  

>15097 133 247     7p15.3    chr7:24189042-24189126 BLAT!
GTAATCCCAGCTACTCAGGAGGCTGAGGTAGGAGAATCACTTGAACCCAGGAGGCGAAGG
TTGCAGAGAGCCAAGGTTGCACCACTGTACTTCCCCTACAACAGCTGTTCATGATAGAGA
AAAATTTTAAAGT


invisible?    
Gene introns: 0  

>17414 138 247     13q22.2    chr13:75725535-75725672 BLAT!
CAGGCCCTTCTGGTTCTCTGTGTATGTGCAGACAAAGCAGCTCCAGGAGCCGACAGTCTG
CAGAAGGCAGTCTGAAGGTGTGGGCCATTAGAAGCAAGAGCACACAGGAGCTGGGGGCAG
CTGCAAACAGAAGGAAAA


invisible?    
Gene introns: 0  

>4503 113 246     6p21.1    chr6:42576208-42576096 BLAT!
TTTTTTTTGTAGAGTCGGGGTCTTGCTCTGTTGCCCAGGCTGGTCCCAAACTCTTGGCCT
CAAGCGATCCTCTTGCCTCTGCTTTCCAAAATGCTAGGATTACAGGATTACAG


invisible?    
Gene introns: UBR2 (42531759 - 42661243)  

>11477 113 246     6q22.33    chr6:127707095-127706983 BLAT!
CAGCCAGCTCACAAAACTCCCGAGAAGTTATTAATTGGCTCTCATGAGCTGGCATCAGGA
AACTGCAGCACACTACTGATTCTCCCCTTTGAGAGTGCCTATCACATACCTCA


invisible?    
Gene introns: 0  

>11581 104 246     18q12.2    chr18:36365996-36365893 BLAT!
CCACACACATGCCATTTATCCCCCTTTTTGGATATACTTTGTGGGGAAATATGGGCATGC
ATGGAAAACACATGTTGCAGGTAAAGGGGGCTGAAAGGGGTTTT


invisible?    
Gene introns: 0  

>13120 152 246     12q23.1    chr12:98857885-98858036 BLAT!
AATTTACAAAGGTTTTTCCTACATCTAAGATAGAAGTCAGATTGTATCTAGAGTTCTTTC
CCTCACTGTTATGAACTGTGACATGATCATATTGAAGAGGGAGAAATGAAGGACATTGTA
ACTCATTAAATGCATAAGACCCAGAAATAATA


invisible?    
Gene introns: 0  

>20200 133 246     2q32.2    chr2:189878471-189878339 BLAT!
TTAACTCGTGTGTTCATTAAACTGAGTATTGGGATCAATAACACACAATAAGTTAGAGCT
ATATATAATGAAATGAACTACTCTCTGTGATACATTAAGTTACAAATACAGGAGGCAGAA
CATTGTGTTCCAG


invisible?    
Gene introns: 0  

>4950 106 244     5p14.1    chr5:26167702-26167807 BLAT!
AAGCCATTTTTTATGGTATTATTTTACAATGATGCATCTCTTTCCTCTCTAGATTTCAAA
CTGAAACCTAATGAACTTTTCACAAAATTCAATGCTGATATTAGAT


invisible?    
Gene introns: 0  

>10319 107 244     12q13.2    chr12:55309771-55309665 BLAT!
TTGGCGGGGGGAAGTTGAAAGATATGGTCTGTTGTTGAGGGAGAAAAGACATTTATTACT
TACAAGGTAACCATAAAGTTTCTAAAATAGTAATATAACTGTATTAA


invisible?    
Gene introns: 0  

>18456 131 244     2q21.2    chr2:132654596-132654466 BLAT!
TATTTTGGGTAGTGGCTCCTTATCAGATAGGTGGTTTGCAAATATTTTCTGCCATTCCGT
AGGTTTTCTCTTCACTCTGCTGATTGTTTCTTTGGCTGTGCAAAAGCTTTCTATTTGATG
TGATCCTATTT


invisible?    
Gene introns: 0  

>22068 145 244     3p12.1    chr3:86286011-86285867 BLAT!
TCAAAATACTAATACATAAGAGTATTAAATATCATTCACCATGATGGTTTACAATTTTTA
ATGCAAAAAAGAAAATTATGAATCATTGCTATGCTTAGTGCAATCCTTCAAAAACATCAA
AGATATTTCAAAAGATGAAATAAGT


invisible?    
Gene introns: 0  

>6417 141 243     16p11.2    chr16:33866667-33866743 BLAT!
ATGTAATGGATTGGAATGGAGTGGAATGTAATGGAATGGATTGGAATGGAATGGAATCAA
CACAAATGGAAAGGAATGGAATGGAATGGAATAGAATGGAAAGGAATGGAATGCAATGGA
ATGGAATGGAATGGAATGGAA


invisible?    
Gene introns: 0  

>8669 113 243     18p11.21    chr18:12044248-12044360 BLAT!
GTTCCAGCTCTCAGGGGACTTTGTCTCAATAAGGTCTCTCAGCCCATAAGGGACCTCTGT
CATCTGTCCCCTCGTTGCCTTATTGACCAAGAAAGTCTCATCTCAGTATCACC


invisible?    
Gene introns: 0  

>16228 128 243     2p22.3    chr2:35820458-35820331 BLAT!
AACAAATGCATTGAGGAAGTCAAGCCTGCAAAGGTAAGAAAAGGGAAGAAGGAGCTGATA
TCAGCTGATACAGGTCCACAGCTGGATCTTCAGATACATGAAGAAGAAGGGAAGAAGGAA
GGATAAAA


invisible?    
Gene introns: 0  

Shown 1501-1530 from 1945 sequences on 51 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs