Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1651-1680 from 1945 sequences on 56 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>4195 123 212     2p11.2    chr2:88664212-88664332 BLAT!
CAGGCTAGCTGAGGCTTCTGGGCCTCTCCTTGTGCCTCTTCATATTCTTCTTCTGGTTTC
AGCTGAGGGCCAGGGATCATCACCGTCTTAAGGATGGGCTGCTTAGGGGGTGCCCATGGG
GGA


invisible?    
Gene introns: 0  

>5026 105 212     6q13    chr6:75581656-75581580 BLAT!
ATTCAAGTTGAGATTTGAATGGTTCACGGCCAAACCACATCACTCACATTCTATTATTTG
TTCACATGTAACCACCTTCCCCAGACTATGAGTGCTTGAGGGCTC


invisible?    
Gene introns: 0  

>7259 109 212     11p12    chr11:39891948-39892056 BLAT!
GCCACATTTAAAACAAATACTTGTTCAATTATGATTAAATACATACATTATTTAAAACTG
AGCTTGATAATCACACCAAGCTTGAAAATCACAGTTTTAAGCATCTGCT


invisible?    
Gene introns: 0  

>14291 120 212     13q14.2    chr13:50552508-50552389 BLAT!
AGGGCCTCTAAAACCGATGGAAGTGAAGTGCTACACCTCAGAGCTGCTTTAGCCCTTAGA
GCTGGCCAGGGTCTGAGTGGGCCTCTCACAGGGCCACAGGACTGCCCTTTCCCCCAGCAT


invisible?    
Gene introns: 0  

>16125 111 212     19p13.11    chr19:17046995-17046885 BLAT!
GAGGCCAAGGTGGGTGGAGAACTTGAGTCCAGGAGTTCAAGACCAGCCTGGCCAACATGA
TGAGACCCTGTCTCTACAAAAATACAAAATATTAGCTGGGCATGGTGGCTT


invisible?    
Gene introns: CPAMD8 (17003761 - 17137625)  

>17254 114 212     14q32.12    chr14:92766110-92766223 BLAT!
TACACTTGTAATCCCAGCGCTGCAGGAGGTGGAGGTGATGATGGGAGGATCGCGTAAGGA
CAGGAGTTGGAGACCAGCCTGGGCAACACAGCGAGACTCTATCTCTACAGATAA


invisible?    
Gene introns: 0  

>17393 131 212     13q33.2    chr13:106826485-106826355 BLAT!
TTTGAACCTCAGGGTCTTTTGTGGCATTCTTGTGTCTTCTCTCCTTTCACTGAAACGTGA
AACAACCCACAATTGTTTGCTTGTATAACCCTTTCTTTTTTATATACATGCCGTAGGATG
AAGCATAATTT


invisible?    
Gene introns: 0  

>22092 113 212     8p21.2    chr8:26593592-26593480 BLAT!
CCAGCTAATTTTTGTATTTTTAGTAGAGACAGAGTTTCATCATGTTAGCCAGGATGGTCT
CAATCTCTTGACCTAGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGATT


invisible?    
Gene introns: 0  

>21550 126 211     6q21    chr6:110238341-110238216 BLAT!
AGAGAAGCATCTACTGAGAAGCACCTCGCATCAGCCGCAGCTCTGAGTTTCCACATACAT
TATCTCCTATATCACCGCATGCTGGAGTTAACATCCTGAGCTAGTAAGCTCAGGCTTTGT
GACTTC


invisible?    
Gene introns: 0  

>12657 109 210     2p11.1    chr2:92189002-92189110 BLAT!
TAGTATTCACTCCAGTTAAAGAACTCTTTCAAAAGACCTCATGCCTGGTCTCATGGAGAT
TCAAAGGTGTTTGAGTCCTTCCTTATTATGCCCTTGGAAGATACTTTGA


invisible?    
Gene introns: 0  

>20316 111 210     5q12.1    chr5:60637959-60637849 BLAT!
CGAGGTGGGTGGATCACTTGAGGTCAGGAGTGCAAGACTAGCCTGGCCAACATGGTGAAA
CCCCAACCCTACTAAAAATACAAAAGTTAGCCAGGCGTCATGGCGCATGTC


invisible?    
Gene introns: ZSWIM6 (60628099 - 60841999)  

>20356 106 210     6q22.31    chr6:120490357-120490462 BLAT!
TGTATTTTCCTGCACATTTGCAAACTTGGTAATATTTAGCTAGATGGCAAACATTGTTAA
TTTTAACTTTTTGTTTGCTGGATATTTTTTGTATCTCTATAAATAT


invisible?    
Gene introns: 0  

>20438 123 210     18q23    chr18:75581708-75581586 BLAT!
AGGCAATGTCACCGTGTTAACAGGCTTCTGAGTGACAACATCCCTTCTGCAGCCTTGCTC
TCTGTGTTTTTCTACTTATTTTCATTATGTTTCCCTCTCTTTTCCCTACAGGGTCCTTTA
CCC


invisible?    
Gene introns: 0  

>22545 121 210     8q22.3    chr8:102222508-102222628 BLAT!
TGAAAAAATGCTCACCATTCTTAGTCATCAAAGAATGCAAATCAAAATATGAGATAGTAT
TATACTTCACACGCACTGGGATGGCTGTAATCGAAAAGACAGATGATAACAAGTATTGGA
G


invisible?    
Gene introns: 0  

>7945 105 209     4p11    chr4:49657536-49657488 BLAT!
TATTACTTTCCTTTCCATTCCATTCCCTTCCATACCACTCTGGTTGATTCCATTCCTTTC
CATTCTACTCGAATACATTCCCTCCTATTCCACTCGGAACGATTC


invisible?    
Gene introns: 0  

>11478 110 209     13q14.3    chr13:53826567-53826458 BLAT!
ACCAAAGCATTTTCTGAGCCTTTTTTTCACTTCTTTGATCACAGATCCTCTTTGTGGGAA
AGCAAGTCCAAATACCATAAAGGAAGGATATGCAGTAACATAATATAAAA


invisible?    
Gene introns: 0  

>11780 111 209     14q31.3    chr14:86745588-86745478 BLAT!
TCCAACCTCTTTGCTAATGCATAATAAAAGTTACCTTAGCTCCAGTTCTCAATGAGTCCC
TCGTCTCTACCTAACACCCCCTCAGCCTGCACTTCATTGTCCATATCACTA


invisible?    
Gene introns: 0  

>3399 104 208     18q21.31    chr18:53957121-53957224 BLAT!
TCTCTCTCTCTCAGTCTCTCTCTCTCCCTCTGTCTCTAAGCCATCCTCTTGTATACTGGC
TCTGTTAACTTCATCTGACACAGTCTGCTCTGCCTTTTCCAGAA


invisible?    
Gene introns: 0  

>20686 102 208     11p14.3    chr11:21840758-21840657 BLAT!
GAACTTCAAGATATAGTTTCTTTCCACTGATGCAGATGTCATATAAATATAAGATGGAAT
AATTCTGTATATAAGATACATATTCTGACTTTTTTCGGCTAA


invisible?    
Gene introns: 0  

>20719 106 208     14q12    chr14:25166583-25166478 BLAT!
CTTCCACTCACTCACCTTCCACTCACTCACTCCCCCACTCACTCACCTTCCATCACTCAC
TCCTCCACTCACTCATCTTCCACTCACTCACTCCTCCACTCACTCA


invisible?    
Gene introns: 0  

>8232 106 207     1p35.3    chr1:29766337-29766232 BLAT!
GGCAGGATGGCCTCAGGCGGTCTGCAGCTCCCATTTGGGCTCATGGTCTGAACTGTCTCT
CACTACATCAGTTGTTTCTTCTGCCGTGGGAGCAGAGTTCCGTGTT


invisible?    
Gene introns: 0  

>22060 115 207     5p15.2    chr5:14905472-14905586 BLAT!
CTACACACTGAAAGGATGTGAAGTAAATACAATAATGCGTGGAAACATATCCTTAGACCA
ACGATCACGTCTAGGTTTGAATTAAGTCATGATCCTAGGTTGTCTTAGGTAATGT


invisible?    
Gene introns: 0  

>4834 128 206     13q31.1    chr13:79541416-79541289 BLAT!
CACTTTTCAGTTGGAAGGGACCTCTTTCCCTGATCTTCAGGCCAAAAATATGGAATTTAA
CTTGGGGCTAAATTCCTTGCTGCCTTTGCATACTGAATAACTCCAATGATTGTGGCCATC
TCAGGCAA


invisible?    
Gene introns: 0  

>6226 127 206     2p25.1    chr2:7703279-7703153 BLAT!
CATTGGACAGGGCTCTGTGTTAGGTGCTATGGGGGGTTACAAAGATTAAGGTAGATATTC
TGCCCTCAAGAGGGAAATAATTTAGTTCAGAAGGCAAAGCATATAAAACAAAAGATCTTC
ATATCTG


invisible?    
Gene introns: 0  

>19684 116 206     13q13.1    chr13:32709168-32709283 BLAT!
ATCACAAAATCAACAATTTTATTAATATAATATTCACATGCATCTCTATTTCAGGCTGTT
AAAAATGAAGTAAATGTTCCCTGCCTTAGAAATTTTGTGGAAAGCCTGTATGACAC


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>3843 119 205     2q34    chr2:210043653-210043535 BLAT!
AACTCCTGCCAATGCACTTACTGCAGCTGCTGAGGTAACCGAGGATTTACTGAAGAGCCG
CTCAGCTTCCTTAAACTTCCGGTTCCTTCGATCATTTTTGCTATTGGAGTTTTTTTGGT


invisible?    
Gene introns: 0  

>7130 100 205     4p11    chr4:49658821-49658740 BLAT!
ATTCCATTCCATTCCGTTCCATTCCGTTCCATTCCATTCTATTCCATTCCGTTCCGTTCC
GTTCCTTTCCGTTCCATTCCATTCTATTCGGGTTAATTCC


invisible?    
Gene introns: 0  

>11113 124 205     Xp22.31    chrX:7458826-7458703 BLAT!
TGGAACTAAAATTTTAAAAAAACATACACATCTAGCGTTTTCTGAGAAAGAAAGAGTGTG
TTTTCCTTGGATCTATCTTTTGGAGGATATCAGTTGCATAAACTGTCTTCCCAGAGTTAC
AGAT


invisible?    
Gene introns: 0  

>14426 103 205     18q12.2    chr18:33562661-33562559 BLAT!
GAACATTCATATATAGGTTTTTGTGTGGACATCTGTTTTCAGTTATCTCGGGTATATGCC
TGAATGGAATTGTTGGGTCATATGGTAACTCTGTTTAAATTTT


invisible?    
Gene introns: 0  

>3237 130 204     Xq12    chrX:66215599-66215728 BLAT!
AACAATGTTACATCTTTCAATTTATAAACATATATATTTTTTCATTTATTTTGGTGTTCT
TTAATTTATTTTAACATTTTGTAGTTTTTACAAATTCAAATTTTTCATTTGATTTGTTAG
GTTTATTGCC


invisible?    
Gene introns: 0  

Shown 1651-1680 from 1945 sequences on 56 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs