Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1711-1740 from 1945 sequences on 58 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>18618 128 198     5p13.1    chr5:40632284-40632157 BLAT!
TCAAATTACGTATGTTAGGTGGAGCACAGTGGTAAAAACACAAACTGCCGGGTTCATACT
CCCAGCTTTGTGACTTATTAGCTACAATGACTTTGGGCCAGTTACCTAACGTATTTGTTC
CTCAGATT


invisible?    
Gene introns: 0  

>3032 132 197     2p25.1    chr2:11650017-11650148 BLAT!
GATATTTTGTAAGAGCAGCTCCAATGGGCTAAGACAATTCAATTTCCCCTTATTTCATTA
GCATGTTTTTGCAGTTGGTCTGTTTGCTAGAATCAGGATCCAATAAAAAGTCAATGCATT
TTGCTTTTTATT


invisible?    
Gene introns: 0  

>4705 106 197     2q14.3    chr2:123445895-123445790 BLAT!
ATGCAACAGTAAATGTGAGACATAGTTCACCTGAAAAGGGACTTAAGGCCTAATGAGGAC
TTACAGTCAATTTCAAATAAATTGAATTATGCACATGTTATAACGT


invisible?    
Gene introns: 0  

>8203 125 197     1p11.2    chr1:120819537-120819414 BLAT!
GGAACCATTAGCATGTAGCTTTTTAGGATTGGCCTTTTTTTTTTCACTCAGCACAAGTCT
CTGAAGACTCATTCAGGTTGTTGTGCATATCAATAGTGTATCCCTTTTTATTGCTGAGCA
GTATT


invisible?    
Gene introns: 0  

>15812 104 197     2q37.1    chr2:231844249-231844147 BLAT!
TGTCAGGTATCACATCTGGAGTAAATAATGTCAGGTATCACATCTGCAGTAAAAAACATC
AGTATCACATCTGGAGTAAATAACATCAGGTATCACATCGGGAG


invisible?    
Gene introns: 0  

>15938 132 197     6q11.1    chr6:62028545-62028676 BLAT!
TATGGATTATATTTATTTACTGTGTTATTAGTGTGTGTTCCAAAATTGTGTGAGATTATG
ACTCTGATGTCTTAGCATATGTTATCAGTAGTCATAATTATTATGTAAAATTGCTGTATA
CCACAGAAATAA


invisible?    
Gene introns: 0  

>2951 107 196     7q36.3    chr7:159090013-159090119 BLAT!
CTCATCATTTAGCTCCCACTTACAAGTGAGAACATGTGGTATTTGGTTTTCTGTTTTGCT
AAGGATAATGGCCTCCATCTCCATCCATGTTCCCACAAAAGACATGA


invisible?    
Gene introns: 0  

>6544 125 196     7q22.1    chr7:98343832-98343952 BLAT!
CTTGAGCCCAGGAGTTCAAGACCAGCCTGGGCAACATAGCAAGACCCCATCTCCATAAAA
AAATTAAAAAATTAGCTGGGCATGGTGGTGTGTGCCCGTGATCCCAGCTACCCTGGAGGC
TGGGG


invisible?    
Gene introns: 0  

>18872 137 196     4q13.1    chr4:64181094-64181230 BLAT!
GGGTGAAATTTTGAGTTGTTATTTATACTTCAGATCTTCTGGGATTAGCCTACCTCTAGG
ACTTTAACACAAATCCCACCCTTGCTACACTTCCCCTGTTCCATCCTGCTTCTTCCACAC
TCTTTCTGGATTCTCCT


invisible?    
Gene introns: 0  

>20517 126 196     5p14.1    chr5:26202925-26202800 BLAT!
AACATATTTTCTTTATCCATCTATCTATTGACGGACATTTGGTTTGTTTCTATATCTTGG
ATATTAAAGATAGTCCTGCAACAAAAATAATGTGGCAATGAACATTGATGTATATCTCTT
CCAGAT


invisible?    
Gene introns: 0  

>7317 120 195     2q24.2    chr2:161395959-161395840 BLAT!
CATTAAGCACATGAATTAGTCAACATCATTAGTTTCCAGGGAAATGCAAATTAGAATCAT
AATGAGATGCTAGGACACATCCAAATTAAAATGACTAAAATTAAAAAGACTAAAAAAAAA


invisible?    
Gene introns: 0  

>10725 104 195     5p13.1    chr5:39584862-39584965 BLAT!
AGGAGATGAGGTTGAAGAAGATACAATTCAGATTATAAAAAAATTATTTTAGTTCTGGGA
CAGACTTTTGAATTACATTGTTTCTTCTTAGCTAAATTTTCCTA


invisible?    
Gene introns: 0  

>15679 106 195     10q23.1    chr10:82860634-82860529 BLAT!
CCTTTTTCAGCGCCATGACATACGTAACCACTTCCATCTGATTTTTTGGATTAATGCTTA
CATTGCAACAGGCAACACCGCAGAAGGTTCAAACAAAAGACTTTGC


invisible?    
Gene introns: 0  

>19903 108 195     Un_gl0002160    chrUn_gl000216:35752-35669 BLAT!
GAACGGAATGGAATGGAATGGAATGGAATGGAATGGAACAGAACGGAACGGAACGGAACG
GAGTGGAAAGGAATGGAATGGAATTGTATGGAATGGAATGGAATGGTA


invisible?    
Gene introns: 0  

>14046 132 194     10q11.23    chr10:52487118-52487249 BLAT!
CTTCTAGTTTACCCATCAGACATAGTGAGGCAATGCCACAAAAAGTAGATCCTCCATGAG
ATTCAAGTCCAGCTCCCTGTGCCAGTCCATTGTCATAGGACATACTCCTTCTAATATAGG
TGATGGCTTTTT


invisible?    
Gene introns: 0  

>14729 115 194     5q32    chr5:148184279-148184393 BLAT!
ACAGAGACTGGGTTCAAGTCTCAATTCAGCCACATACGAGCTGGGGGACCTAAAACAAGT
CATTTATTTTTGCCTCCTGTCAGCCTCAATTTCCTCACCTGCAATTCTGCCTGCC


invisible?    
Gene introns: 0  

>16259 127 194     6q23.3    chr6:136523899-136524025 BLAT!
TTGGAACTTGGGGGTAAGTAGTCAAAATGAAAATAAAAGAAATAGAGAAGCTGAGCACAG
CTGCTGATGCCTGTAATCCCAATACTTTAGGAGGCCGAGGCAGGAGGATCACTTGAGGCT
AGGAGTT


invisible?    
Gene introns: 0  

>21664 118 194     Xq23    chrX:116341338-116341221 BLAT!
AGTATACCATGAAAAGAGATACCCCCCCATGTGAGGAAGGAGAGGAATTAAGCACTGGAC
TTTGCCTTCAACCCCAAACTAGGTCTTCGCAGTTAAAACTCAATGCCAGGCAGGCCCC


invisible?    
Gene introns: 0  

>14258 102 192     11q14.3    chr11:88619387-88619488 BLAT!
ACTTCTCATATGTGTCTGTGTCCTAAATTTTCCTGGTGCGTGACGACAAACCCTGGGTTT
ACACCCCAGACATAGCTGCTTTATAATGGGGGCTCGTCCGGG


invisible?    
Gene introns: GRM5 (88237743 - 88796816)  

>14579 104 192     4p15.33    chr4:13054315-13054418 BLAT!
TGAGCTGATGGGACATGAGAATTTAGGTATCATTTGGGTTAATTGAGGAGAGAACAAAGG
GCAGAGAAGAAGAAAAGAAACATGATTATTAACCCTGGGGGTTC


invisible?    
Gene introns: 0  

>16559 126 192     5p13.2    chr5:34271244-34271119 BLAT!
AACTTTGTGTTTGCAGATTCATCACCTCCCTCAGCATTCAGAGAATCTAAGAGAATCTGT
TTTAGCCTTCTACATGCCTTCCTCACTGAGCTTAATTATTTCTACCTTTTGATTTAAAAA
TGAGAG


invisible?    
Gene introns: 0  

>20530 129 192     19p13.12    chr19:14119626-14119754 BLAT!
TGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCAAGTTCAGGAGTTCCAGAACAGTC
TGGCCAACACGGCGAAATCCTGTCTCTACTAAAAATACTAAAATAGGTCGGTGTGGTGGC
ACGTGCCTG


invisible?    
Gene introns: 0  

>21821 100 192     7q32.1    chr7:128302411-128302312 BLAT!
AGCTGGGGCAGCTGGGATGCAGTGGACCAAACCCCAGGCTGCACATAGCTTGGGGACCCT
GGGCCCAGCCCATGAAACCACTTTTTCCTCCTAGGCTTCT


invisible?    
Gene introns: 0  

>4605 105 191     1q32.1    chr1:201072192-201072088 BLAT!
ACCATGTTGGTCAGGCTGGTCCACAATATCTTTCTTTTCAGGACTGTTATATCCATGAGT
GCAACAACCTCGTGTCTGACCTGGCACACAAGAGTTGCTCAATAA


invisible?    
Gene introns: CACNA1S (201008639 - 201081694)  

>12185 127 191     1q24.3    chr1:172718230-172718104 BLAT!
ATGCTCCTCAGGGCAGCGTAGATACTCTCATAGCCATATTTCCCACTCTCATAGCGCGTC
TTGATTACAGTGATAGGTGACATACAGACCCCTGCAACAGAGCGAGAGCCCACCCCCAGC
ATGACTG


invisible?    
Gene introns: 0  

>17045 110 191     4p15.2    chr4:26513969-26514078 BLAT!
GGCCTTAGAAGATGTATCATTTTTGATCTTTCAAGAAGCAGAGGCCAAGATGGAATTAGA
AGAAAAAAGATTTATTGGGGGAAGTATCTGTAGGATAAAAGGAAGAGGGA


invisible?    
Gene introns: 0  

>17537 124 191     4q27    chr4:122213866-122213743 BLAT!
TTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGTGCAGGCTGGTCTCGAAATCC
TGACCTCAGGTGATCAACCTACCTGGGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCC
ACCA


invisible?    
Gene introns: 0  

>17553 121 191     5q14.3    chr5:86796562-86796442 BLAT!
GACTTCAAATTGAGAATTATTTCTGGGTGTAGCTTATGGGTAACATAATGGCCCATATGT
TTTATCTGAAATATGATTATTGTTACTCAAGTAGTCTTCATCCCAAATATACATTTATTG
A


invisible?    
Gene introns: 0  

>20057 134 191     4q28.3    chr4:135639844-135639977 BLAT!
ATCTCAAATACACCTCTACTGTGTGACCTAGTAATTCTTACTATTTCCAAAAACAATATG
AGATAAAACATTTCCCTTTCTGAATGAAAATACCTAATGTGCACCTGTGAAATCTTTCAT
TAATGCCCTTGTTT


invisible?    
Gene introns: 0  

>7698 101 190     6q11.1    chr6:63247295-63247195 BLAT!
ACCATCTATAAAGAGGCAAAACTATCTCAATCTTAATTCCAGGCTTGTTCAAGACAAGAC
AATTTAATATTATGAAGGAGGGTAGAACTAGAGAATCCCTA


invisible?    
Gene introns: 0  

Shown 1711-1740 from 1945 sequences on 58 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs