Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 1921-1945 from 1945 sequences on 65 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>11808 100 138     13q31.3    chr13:90814707-90814643 BLAT!
GCTACCCTTTTACCATCATTGGACAAGTAGCATCCGTACTGGGGTTACAGGAGTGAGCCA
CCATGTCTGACCCTAATTATTCTTTACATGTGTCACCGCC


invisible?    
Gene introns: 0  

>21708 100 138     1p22.1    chr1:93428289-93428190 BLAT!
GAAGGGGCAGACATGAAGGTATCTCTTCAGAACAAGGCACCTGAACAAGGCTTATGCAAA
AACCAAGTGAGAATGAGTAATGGTTTGCTTCTGGGGAAAC


invisible?    
Gene introns: 0  

>14434 100 137     5q34    chr5:165357398-165357497 BLAT!
CCAAAGGATTATAAATCATGCTACTATAAAGACACATGCACATGTATGTTTATTGAGGCA
CTATTCACAATAGCAAAGGCTTGGAACCAACCCAAATGTC


invisible?    
Gene introns: 0  

>12937 107 136     9q21.12    chr9:72611416-72611522 BLAT!
TTGCCACATGACATGCCTACTACTGCTTCATCTTCTACCATGATTGTAAACTTCCTGAGG
CCTCACCAGAATCAGATGCTGACACCATACTTCTTGCATGGTTTGCA


invisible?    
Gene introns: 0  

>14041 106 136     17q23.2    chr17:60317787-60317892 BLAT!
TTGGGAAGCCAAGTCAGGTAGATCAACTGAGCTCAGGAGTTTGAGACCACCCTGGGCAAC
ATGATGAAACCCCATTTCTACAAAAAATACCAAAAATTAGCCAGGC


invisible?    
Gene introns: 0  

>19776 103 136     3p13    chr3:70078374-70078272 BLAT!
CTGAAAAGAAGGACGGGTTAAGTGTATTATTCTGATAAAAACCAATGCACTGGGCAATGA
AATTATTTATTTTCAAGTCCAGTCTATGACTTGATACTTCCTA


invisible?    
Gene introns: 0  

>19359 106 135     11q14.3    chr11:91783683-91783788 BLAT!
GACAACTGGGTTAAGTGCCAAAGAACTCACATGGGTTTGTGATCAGTAAATAAGGTAACA
TATTAAAGCACCAACACAATGCCTGGCTCATAGAAGATATGCAAAA


invisible?    
Gene introns: 0  

>19669 106 134     Xq26.2    chrX:132321028-132321133 BLAT!
TGGTCTGGAATACTAATAGGTTCACATTCTTGGTGTCTTCAAGAAGAGCTCACTGCTGAG
GAAAATCTACTGGATGAAGGGAATAAAAGGGGGAATAGAGTATAGG


invisible?    
Gene introns: 0  

>17834 102 131     7q34    chr7:141503897-141503796 BLAT!
GATATGATTTATCTCCACATTAGCAGAAACTATCCGAGCCCCTTTTGATCTAACCGGAGA
GTCAGAGTTAGTCTCAGGCTTCAACATTGAACATGCCACAGG


invisible?    
Gene introns: 0  

>17569 102 130     2p14    chr2:68129665-68129766 BLAT!
GGAGGGTGCAAATGACTCATGTTTTTAATATTTTACTACTAACTGATCTTAAAGGTCATA
CCTATGTGTTTCTATGCTCAACATAAATTTAATTTTAAAAGA


invisible?    
Gene introns: 0  

>6213 100 129     14q23.3    chr14:66509624-66509525 BLAT!
TATCACCCTGATCTGAGCTACTATCATGTCTCACCTGGATTATTATGAAAGCCTTCCTGC
TATCATGTTCTTCCTGCTTCTATATTTTTCTCCACTACCT


invisible?    
Gene introns: 0  

>14856 101 129     3q28    chr3:191513185-191513085 BLAT!
TTGCAATAAAAATGTCACAGGGCATATTGCAAAATAGTAAACAATGGCCAATTCAATGGG
AAAAAAATCCAGAAAATGTCCCCACAAAACACCTGGCAGCA


invisible?    
Gene introns: 0  

>21932 100 129     10q23.31    chr10:89982046-89981947 BLAT!
CTCAGATGTGGGTTGGATTATTTCTGCCTGTTTCTATTAGGACAGCTTCCAAGGTGGGTT
GAATCCTAGGACGAGCCAAGCTGACCAGACTTCCCTTGTC


invisible?    
Gene introns: 0  

>4328 101 128     12p13.31    chr12:5923240-5923140 BLAT!
GTAGGAAGCCAGAGAGCACAGCAGCCTGTTCATGTCAGATAGAGGACCGTAGAGAGTATA
TCTGGAAGGGGAAGATGGAAGATAGGCACACAGCTGGCAAG


invisible?    
Gene introns: ANO2 (5671816 - 6055398)  

>11743 102 127     2q22.1    chr2:140208174-140208275 BLAT!
TCATAGCTTGTATAAGAATTTTCATCTTTTTTCTGATGCTCTTTTTTAACAAAATTTTAT
AGATACATACTATTTTACATATTTATGGGTTACATGTGATAT


invisible?    
Gene introns: 0  

>8798 101 126     13q21.33    chr13:69204984-69204884 BLAT!
ACTTATAACTGACTTACTCTAGGGAACAGTTAAAGAAGATAATAAAGAGGGAGCAAAAAA
AGTCATATAATTATTCCATAACATTCTCTTTTATTTTAATC


invisible?    
Gene introns: 0  

>15632 100 122     7p12.1    chr7:52491883-52491784 BLAT!
TGTTACTTTTTACTTTCTGCTCTGTATTGATTCAGTTATTTAAAATTAGTAGGTAACATT
ATGACAAATTTAAAATGTCAATAATATAAAATTATAGCTT


invisible?    
Gene introns: 0  

>1721 135 0     1p36.23    chr1:7474345-7474383 BLAT!
GGATTCGGTTTGCCAGTATTTTATTGAGGATTTTTGCATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGGATTCCCTCTTTTTCTATTG
ATTGGAATAGTTTCA


invisible?    
Gene introns: CAMTA1 (6845383 - 7829766)  

>1739 113 0     Xq21.33    chrX:97524835-97524940 BLAT!
CAATTTTAATTTCACCCCAGTCCTGTGGTCCTGTGATCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNTCTTATTACCTTGTGAAGCATGGGATCTCTGTGACCCAT


invisible?    
Gene introns: 0  

>23138 149 0     11q13.4    chr11:73376410-73376448 BLAT!
GCGGCCGAGGTACTGGAAGATGAATGAGATTTGGGCCCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGGCTGTG
GGAACTGGTAGCCCTGAGGCTGTAGGGTC


invisible?    
Gene introns: 0  

>23262 127 0     13q22.1    chr13:73689091-73689053 BLAT!
GTAACAAGTTAATATTAAAAATGCTTCTTCATATGGTCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGAACGTTCAAGGAATCACAATTTTTGAGCTTT
TACATCC


invisible?    
Gene introns: 0  

>23276 111 0     14q32.11    chr14:90833333-90833371 BLAT!
CAACTGGCAAAGTGAAAAGGGGGTATATGAGGGAATACTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACTCTTCCAGTTTTGCCATGGTAACACTTGTGGGGCATT


invisible?    
Gene introns: 0  

>23287 132 0     2q13    chr2:112346650-112346781 BLAT!
TGAAACTATTCCAATCAATAGAAAAAGAGGGAATCCTCCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGAATTTTAGACCAATATCCCTGATG
AACATCAATGCA


invisible?    
Gene introns: 0  

>23300 111 0     13q12.3    chr13:30502647-30502685 BLAT!
CGCGGGGCTATATCTCCTGTAGTAATAACACAGGGGTTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNGAAGTTTCTGGGGAAACTGGATTTTATCCCTATATTTCT


invisible?    
Gene introns: 0  

>23304 135 0     1p21.1    chr1:106432923-106432961 BLAT!
TAAAAACACTATTGGTTTTGTTCTTTATTGAATGGAATANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTGGTGCAAGTTGTCTTAAGTA
GCTTAGGAAGTCAAT


invisible?    
Gene introns: 0  

Shown 1921-1945 from 1945 sequences on 65 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs