Postparser v2.3 // project Bladder

Databases: ABC1_contigs

Shown 181-210 from 1945 sequences on 7 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

>2048 721 2826 26790-,79944-,14205+,79943+,47599-     3q11.2    chr3:96069406-96069770 BLAT!
CACCACCTAGAGGGGGAGACCTCATGGCCTATGACAGAAGAGGGAGACCTGGAGACCGTT
ACGACGGCATGGTTGGTTTCAGTGCTGATGAAAnCGCGGCCGAGGTACGCGGGGGGTTGG
TTTCAGTGCTGATGAAACTTGGGACTCTGCAATAGATACATGGAGCCCATCAGAATGGCA
GATGGCTTATGAACCACAGGGTGGCTCCGGATATGATTATTCCTATGCAGGGGGTCGTGG
CTCATATGGTGATCTTGGTGGACCTATTATTACTACACAAGTAACTATTCCCAAAGATTT
GGCTGGATCTATTATTGGCAAAGGTGGTCAGCGGATTAAACAAATCCGTCATGAGTCGGG
AGCTTCGATCAAAATTGATGAGCCTTTAGAAGGATCCGAAGATCGGATCATTACCATTAC
AGGAACACAGGACCAGATACAGAATGCACAGTATTTGCTGCAGAACAGTGTGAAGCAGTA
TGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGACTAGTGAAGAACTGAAGGAGTCCTGCAT
CTTTTTTTTTTATCTGCTTCTGTTTAAAAAGCCAACATTCCTCTGCTTCATAGGTGTTCT
GCATTTGAGGTGTAGTGAAATCTTTGCTGTTCACCAGATGTAATGTTTTAGTTCCTTACA
A


invisible?    
Gene introns: 0  

>23111 348 2825     13q33.2    chr13:106812132-106812478 BLAT!
AGGGCTGTGCGCATGAGGACTAAGAAGGAACCTTCTCCACCAGACAGGCGCAACAGCAGG
CAGTTGGTGGACAGCGGGTAACAGTCAGGGACAAAGGGGAGGTAAAGTCAGCACTGGGGG
CAGATGGAAACCAGGGAGAGGGAACAGTGAGAGCAAAGGAACAGCTGTGGGACCAAGCAC
AGATCCAGACGTCAGGAAACGGGGACGTCAAGCCAGAAAAAACACAGCTCTCTAGGTTGA
CATTCCAGCAAGCATGTCATCTCTGGATGGGAACACGATGGTTATAATAAAAGGGAGCTT
GACTAGTTAGTGTCTGAGCAAAAGAGATAAGAACCGTCCAAAATGCAT


invisible?    
Gene introns: 0  

>24046 180 2821 79638+,22876-,159329-     8q12.1    chr8:57330389-57330551 BLAT!
GGAAGTAAAGCTCTCCTCAGCAAATGTAAAAGAACAGAAATTATAACAAACTATCTCTCA
GACCACAGTGCAATCAAACTAGAACTCAGGATTAAGAATCTCACTCAAAACCACTCAACT
ACATGGAAACTGAACAACCTGCTCCTGAATGACTACTGGGTACCTGCCCGGGCGCCGCTC


invisible?    
Gene introns: 0  

>19747 269 2810     Xp11.3    chrX:46278711-46278476 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGTGATGAAAACAGGGAATTGCTTGGGGAGCTGG
ATGGAATCGATGTGCTTCTTCAGCAGTTATCCGTGTTTAAAAGACACAATCCCAGCACGG
CTGAGGAGCAGGAGATGATGGAGAATCTGTTTGATTCCCTCTGCTCCTGTCTAATGCTTA
GTTCCAATCGTGAGCGCTTCCTGAAGGGCGAGGGTCTTCAGCTGATGAATCTCATGCTCA
GGGAAAAGAAGATCTCCCGGAGCAGTGCC


invisible?    
Gene introns: 0  

>98 387 2762     2p22.2    chr2:38044505-38044677 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGTCTCAGGAGATGAATTGATGACCCTGGCTCA
TAAACACATTGTCAAGACTGTGGATTTCACGCAGGATAGTAATTATTTGTTAACCGGGGG
ACAGGATAAACTGTTACGCATATATGACTTGAACAAACCTGAAGCAGAACCTAAGGAAAT
TAGTGGTCATACTTCTGGTATAAAAAAAGCTCTGTGGTGCAGTGAGGATAAACAGATTCT
TTCTGCTGATGACAAAACTGTTCGACTTTGGGATCATGCTACTATGACAGAAGTGAAATC
TCTAAATTTTAATATGTCTGTTAGTAGTATGGAATATATTCCTGAGGGAGAGGTTTTGGT
TATAACTTATGGACGATCTATTGCTTT


invisible?    
Gene introns: 0  

>23692 484 2748 39546+,202610-,16341+     3q25.2    chr3:154071381-154071107 BLAT!
GTGGAACATCATATCAAAGCCAAATTAATCATATTCGAAATGGTATTGACATCTTGGTTG
GAACACCTGGTCGTATCAAAGACCATCTGCAGAGTGGCCGATTGGATCTTTCTAAACTGC
GACATGTTGTGCTTGATGAAGTGGATCAGATGTTAGATTTAGGTTTCGCTGAACAAGTTG
AAGATATTATTCATGAATCCTACAAAACTGATTCTGAAGACAATCCTCAGACTTTACTTT
TTTCTGCAACTTGCCCACAGTGGGTATACAAAGTTGCAAAAAAATnACATGAAATCCAGA
TATGAACAGGTTGACCTTGTTGGAAAAATGACTCAAAAGGCTGCAACTACTGTGGAACAT
TTGGCCATCCAGTGTCATTGGTCTCAGAGGCCAGCAGTTATTGGAGATGTCCTTCAAGTC
TACAGTGGGTCTGAAGGGAGGGCTATTATTTTCTGTGAGACCAAGAAGAATGTAACTGAA
ATGG


invisible?    
Gene introns: GPR149 (154055460 - 154147504)  

>1125 206 2743     2p11.2    chr2:85329551-85329757 BLAT!
CCCCGGACAAAGAGCATTGGAATATTCCGTTTCGTTGATTTATATATCTCTTCATATGTT
TCTTCATCAATTTCTATAGTAGTCACAGTTTCTTCCACATCTCCCAAGATCATATTTAAA
TGTTGATCATAAGCATGTAATCTGCCTCGAAGCTCTCGGTCATTTCTCATTTTCACATAA
ATTCGCTCATCTAGGCTGAGCCTGAT


invisible?    
Gene introns: 0  

>19872 190 2731     20p11.21    chr20:24913061-24913250 BLAT!
AAAAAGATAAAAAATTTGTTTCTCCAATTAGCAGAAAATGTAGCTCATTCCCTTAATGTT
ACTTCTTGTTATATATGCGGGGGAACCACTATCAGAGACCGATGGCCTTGGGAAGCCTGA
GAGTTGGTGCCCACTGATCCAGCTCCTGATATAATGGGGGCTTGTCCAGGATCTCATCAG
GACTGGATGG


invisible?    
Gene introns: 0  

>4464 181 2726     9p23    chr9:12973328-12973463 BLAT!
ATATTTTCCTTTGTAGTCAGACAGGCTGATATCTTTAAACTGACCATCTGGCATAACAGC
TGTGGCTTTGAAGTTGGGGGCAGGGTGCCCAATTTTAGCATTTCCTGAAGACATCTTCCT
ATCAGCAGTCCCAACACAAGTCGCAGAAACTAACCACCGACACCAGGCAAGAACAAGACG
C


invisible?    
Gene introns: 0  

>16251 137 2706     21q22.3    chr21:45276133-45276018 BLAT!
CGCGGCCGAGGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCA
ACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGC
TGGACTTTGAGCACTTT


invisible?    
Gene introns: 0  

>1021 191 2681     5q34    chr5:160345883-160345693 BLAT!
GGTCATTTTCTACCTCTAAGCTTTCACTTAAGTTGTGCCTCCTTGCCTAAGATTGTCATC
TTATGCTTCTCTCCCTTTACCTAGGAAATCCTCCTCTGAGCAAGGTTTATCTACTCCATA
AATTTCCCTTGGCTGGTGGACATTCTGAGATGTTACAGACCTCCCTTTTGTCCCCGTGAT
GATCCAACCCA


invisible?    
Gene introns: 0  

>2320 183 2675 52367+,79999-,17514-     Xq11.2    chrX:63264875-63264785 BLAT!
CTTCGACATGGCTACTTTTATTTCACATTTACTAAGACCAACATTGTGGTATTTCTTTTC
CATTATCTTCTTCACTGGTTCTTCTTCCTTACCCCGCGTACCTGCCCGGGCGGCCGCTCn
GTTGTCCATGGGGAGCTCTATGGATTCCACCTCACCAAAACCACCAAAGTACCTGCCCGG
GCG


invisible?    
Gene introns: 0  

>9301 197 2634     2p11.2    chr2:85329765-85329568 BLAT!
TGGATCTTATCAGGCTCAGCCTAGATGAGCGAATTTATGTGAAAATGAGAAATGACCGAG
AGCTTCGAGGCAGATTACATGCTTATGATCAACATTTAAATATGATCTTGGGAGATGTGG
AAGAAACTGTGACTACTATAGAAATTGATGAAGAAACATATGAAGAGATATATAAATCAA
CGAAACGGAATATTCCA


invisible?    
Gene introns: 0  

>637 232 2623     6p21.2    chr6:36642586-36642817 BLAT!
GGGGAGGCTCATACTGGCTGATGCGCTCTGTTACGCACACACGTTTAACCCGAAGGTCAT
CCTCAATGCCGCCACCTTAACAGGTGCCATGGATGTAGCTTTGGGATCAGGTGCCACTGG
GGTCTTTACCAATTCATCCTGGCTCTGGAACAAACTCTTCGAGGCCAGCATTGAAACAGG
GGACCGTGTCTGGAGGATGCCTCTCTTCGAACATTATACAAGACAGGTTGTA


invisible?    
Gene introns: 0  

>2082 244 2610 30262+,80171+,60078-,19100-     1q25.1    chr1:175250922-175251102 BLAT!
AGTATTGACTTATAACACAAAGTTAAAGCAAATATCCATGAGTCTATAGAGATAAAAATA
AATGATTGAATGAATAAGTAAATGAAAGAGAAGAAACAATTCTCCCATGCAGAAAAATTG
CAAGTAATTTCTGTAGATACTTTGCCCTCAAGGAGATGATGTATAACTCAAGTGTGGTCT
nCCAGTGAGTGGGGTCAACCTCAGCAGTGATAAGTCATGTTGATAGTATGTACCTGCCCG
GGCG


invisible?    
Gene introns: 0  

>2333 314 2608 53218+,79630-,34196-,69303-,39128-,37289-     Xq21.1    chrX:80185734-80185458 BLAT!
TCCTAAACCTATCAGGCTGGAGTTGTTCACTTTAGCCGAGAAGCAGGCGTCAGGGTCAAT
CTGATACTTGGCTGCTATTCCGAAGCGCGTGTTACTGTTTCCTGCTGTCCAGGCAAGATT
GACAGCGGTCTCCAACTTCTTGTTCACTTTCTGGTAAATGGAGCCGCCAAACTCTGTCCC
GTCATTCACATTAGTGTGAAGCTGGAATTCATCAGTCTTGTAGCCAACTGCAAAGTTGCT
CTGGGTCACTCGGGATTTTGCAGTCTCAAAATTCATCCCCGCGTACCTGCCCGGACCTGC
CCGGGCGGCCGCTC


invisible?    
Gene introns: 0  

>3691 172 2577     3q25.31    chr3:155706000-155705829 BLAT!
AAAAAAAGGAAGGTTGGAATCCATCAGTGTTCTATTTAGTCATCTTCTCCTTCATCCTCC
TCTCCTTCCTCCCCTTCATCATCATCTTCATCTTCTTCACCTTCATCCTCATCCCCTTCT
TCGTCAATATCTTCTAATCCTTCCTCCTCTTCATCATCATCATCATCTTCTT


invisible?    
Gene introns: 0  

>7235 303 2540     2q24.1    chr2:156126150-156126453 BLAT!
GCGTCTAACTGAGTTGCTGAAGCAAGGACAGTATTCTCCCATGGCTATTGAAGAACAAGT
GGCTGTTATCTATGCGGGTGTAAGGGGATATCTTGATAAACTGGAGCCCAGCAAGATTAC
AAAGTTTGAGAATGCTTTCTTGTCTCATGTCGTCAGCCAGCACCAAGCCTTGTTGGGCAC
TATCAGGGCTGATGGAAAGATCTCAGAACAATCAGATGCAAAGCTGAAAGAGATTGTAAC
AAATTTCTTGGCTGGATTTGAAGCTTAAACTCCTGTGGATTCACATCAAATACCAGTTCA
GTT


invisible?    
Gene introns: 0  

>4541 182 2520     4p16.1    chr4:8176154-8176280 BLAT!
AGTCAAAGCCTGCACAACAGAAGAGGATCAGGAGAAGCTGATGCAAATTACCAGTCTGCA
TTCACTGAATGCCTTCTTGCTGCCAATTAAAACTGTAGGTGTGCAGGGTGACTGTCGTTC
CTACAGTTACGTGTGTGGAATCTCCAGTAAAGATGAACCTGACTGGGAATCACTTATTTT
TC


invisible?    
Gene introns: 0  

>2103 464 2512 32984-,79854-,9051+     6q14.2    chr6:84206317-84206771 BLAT!
AAGGAAAACTAACAAACAGAAAGGACATCCACACCAAAAACCCATCTATAGGTCACCAAC
ATCAAAGACCAAAGGTAGATAAAACCACAAAGATGGGGAGAAACCAGAGCAGAAAATCTG
AAAATTCTAAAAACCAGAGCACCTCTACTCCTCCAAAGGATCGCAGCTCTTCGCCAGCAA
CAGAACAAAGCTGGATGGAGAATGACTTTGATGAGCTGACAGAAGCAGGCTTCAGAAGGT
TGATAATAACAAACTTCTCTGAGCTAAnTTGAACCCATTGCAAGGAAGCTAAAAACTTTG
AAGAAAGATTAGACGAGTGGCAAACTAGAATAAACAGTGTAGAGAAGACCTTAAATGACC
TGATGGAGCTGAAAGCCATGGCACAAGAACTACGTGATGCATGCACAAGCTTCAATAGCC
GATTCGATCAAGTGGAAGAAAGGGTATCAGTGATTAAAGATTAA


invisible?    
Gene introns: 0  

>24544 251 2493 130079+,204018+,156168-,49420-     1q25.1    chr1:175250919-175251115 BLAT!
AGTAGTATTGACTTATAACACAAAGTTAAAGCAAATATCCATGAGTCTATAGAGATAAAA
ATAAATGATTGAATGAATAAGTAAATGAAAGAGAAGAAACAATTCTCCCATGCAGAAAAA
TTGCAAGTAATTTCTGTAGATACTTTGCCCTCAAGGAGATGATGTATAACTCAAGTGTGG
TCTGCACATAGTGACTnGGGGTCAACCTCAGCAGTGATAAGTCATGTTGATAGTATGTAC
CTGCCCGGGCG


invisible?    
Gene introns: 0  

>8838 218 2487     1p22.1    chr1:93829051-93828834 BLAT!
AAACATTCTCCCTCACAACCTCAATAAAGAGCCAACCCTGCTGATACTTTGATTTAGGCC
TAATGAAACTGATTTTTGGACTTCTGATCTCCAGGACTATAAAAGAATAAATCTGTGTTG
TTTTAAGTCACTAAGTTTGTGGTAATTTGTTACAGTGGCAACAAGAAACTAAAATATTCA
CAAAAATGATGAATGAAAAAAAGTGTATTATGTATGAT


invisible?    
Gene introns: 0  

>18603 303 2485     11q12.3    chr11:61921647-61921345 BLAT!
TTTCCAACAAATGGTGCTGGAACAACTAGACATCCATCCATATGCTCCTAAACACAAACA
AAAAACATAAACCTCATACTTAAAAAAAACTTAAAATAGATCATAAATCTAAACGTTAAC
ATGTAAAATAATAAAACATTTAGAAGAAAACAAAGGAGAATTAGGACCTAGGACTAGACA
ATAGTTTCTTAGACATGACAAAAAAATCACACTCTATTTTAAAAATTTAATTAATTGGAC
TTCATCAAATTAAAATTTTTGTTCTCTGAAAAACACTGGTAAGTAAACAAAAAGACAAGC
TGG


invisible?    
Gene introns: 0  

>24826 403 2481 160947+,203310-,61391-     7p12.3    chr7:48943082-48942797 BLAT!
ATCTAGCCTAATGGGATTGTTTGAAAAACGTCGCTTCAGGAAATTCCTAGTGTATGTTGC
CAACTTCGATGAAAAAGATCCAAGAACTTTTGAAGGCATTGATCCTAAGAAGACCACAAT
GCGAGATGTGTATAAGAAATTTGATTTGGGTCAAGACGTTATAGATTTTACTGGTCATGC
TCTTGCACTTTACAGAACTGATGATTACTTAGATCAACCGTGTTATGAAACCATTAATAG
AATTAAACTTTACAGTGAATCTTTGGCAAGATATGGCAAAAGCCCATACCTTTATCCACT
CTATGGCCTnGCCCCAAGGATTTGCAAGGCTAAGTGCTATTTATGGAGGTACTCATTAAT
CCAGGGCAAAGGTGACCAAATGATGTGGATAATGATTTATTTA


invisible?    
Gene introns: 0  

>12045 260 2459     Xq25    chrX:126526355-126526096 BLAT!
AGCACTGTTGATAACATTAGAAAGTTTAGTTTTCAAGCTTGTGTATGTTACCGTGTTTCT
CACATCACTCTCATAACGTCCAGTGCCCAGGGATACTATGCACTCTAACGGCACATCTGG
CCAAAGACATTTACACTCATGCATAGCTAATGCCGAAGGGTTATTCAGAAGCAAACCTCC
ATCTTGATGAAGATCATTTCCCAATGCATATTCTGCAAAGTAGCCTGGAGCAGCAGATGA
GGCTCTAATGGCCTGCCACA


invisible?    
Gene introns: 0  

>6774 230 2444     10q21.1    chr10:55387913-55387684 BLAT!
AGTTCATCTCCCAACCAACTAAAACTGGAGATTTGTATAGCGAGGAAGGAACATAACTAC
GTGTGGGAAAACAGGAATTAGAGAGGATTAAGGAAGCAATCATGATGGATGAGGATGTCA
TTGTTGGGATATAGTGATCTGGTGAGTTTCAGTTCTTTGATACTATTTGAGGGGGCTGAA
AGTTTCCTGAGAAAGGAACTCAGGTAAGACTAATGTAAGTTTTAAGCTTT


invisible?    
Gene introns: 0  

>20371 246 2431     12p13.31    chr12:8787136-8787371 BLAT!
ACTCTCCCAATTCAAAGGTAAATACACTGAGTAAAGAGCTACATTCAGAGTTCTCAGAAG
TTATGAATGAAATCTGGGCTAGTGATCAAATCAGAAGTGCCGTCCTTATCTCATCAAAGC
CAGGCTGCTTTATTGCAGGTGCTGATATCAACATGTTAGCCGCTTGCAAGACCCTTCAAG
AAGTAACACAGCTATCACAAGAAGCACAGAGAATAGTTGAGAAACTTGAAAAGTCCACAA
AGCCTA


invisible?    
Gene introns: 0  

>8772 317 2407     16q12.1    chr16:52471588-52471272 BLAT!
TCTTAAGCCAAAATAATTATTTCGGTGCCCATTTATTCCCCCCTTTTCTTGCTCTGTAGC
GGTTCCTCTTTGAGAGCAGTGTGACCACTATCCCCAGTTGTCTTGCATGATTAATTACAG
CATCTGTCCTGTCAGAAGCTATAATGAAGAGGTCTTGATAAAAATTGCAAATTACCACTG
GCAACAGTCTTAAACTGCTTATGATAAAATGAAAATTAAAAACAGCAAGTGTCAACCCTG
ACCAGAATCCTAATCTGGAAAGAATGAGGGTGTGCGTGGTGCGCTCCACAGCTACTATGT
GCAAGACATTCAAAAAT


invisible?    
Gene introns: 0  

>9847 366 2384     11q23.2    chr11:113661338-113660993 BLAT!
AACAGGGCATCCAAGTCGAACTCCTTCAAATCCATTTTCTCCAACATCCAATCTGTCCCG
GAGAAGGCATCCTCCTTGCTGTTGTTGGAGGGACTGACCAACCCATCCACAGCCAGCCAT
TCGGAGGAGCCCGCCTTAGCCTTGTCGCTGGAGAACCCATGAGGTTTGAAGTGCTTGGCC
ACCTCCAGGTAATCATCTAAGAGACCTAGGCTTTCTTCAGCCCCCAAACCCGACGGGTCG
AAGGGGGACATCAAGTCCCCCACCAACACCTCGCTGCTCAGGAAGCTCATTTCGGTCATG
TTGCGGTGCTTTGCTGGAATCGAGGAATGTGCTTAATTCGAAGGTGCCCCGCGTACCTCG
GCCGCG


invisible?    
Gene introns: 0  

>12065 327 2381     18q12.1    chr18:29542511-29542829 BLAT!
TGGGGAGCGGAGTCAGTGGTGGAGAGGAAGGGGCCCGGTATGGCCCATCGCTCATGCCAG
GAGGGAACAAAGAAGCGTGGCCCCACATCAAGACCATCTTCCAAGGCATTGCTGCAAAAG
TGGGAACTGGAGAACCCTGCTGTGACTGGGTGGGAGATGAGGGAGCAGGCCACTTCGTGA
AGATGGTGCACAACGGGATAGAGTATGGGGACATGCAGCTGATCTGTGAGGCATACCACC
TGATGAAAGACGTGCTGGGCATGGCGCAGGACGAGATGGCCCAGGCCTTTGAGGATTGGA
ATAAGACAGAGCTAGACTCATTCCTGA


invisible?    
Gene introns: 0  

Shown 181-210 from 1945 sequences on 7 of 65 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65

Databases: ABC1_contigs