Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 271-300 from 3142 sequences on 10 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>29103 243 2478     6p21.2    chr6:36642536-36642778 BLAT!
GTTAGAGCCAAAAACGGGAAGACCATCCAGGTTGATAACACTGATGCTGAGGGGAGGCTC
ATACTGGCTGATGCGCTCTGTTACGCACACACGTTTAACCCGAAGGTCATCCTCAATGCC
GCCACCTTAACAGGTGCCATGGATGTAGCTTTGGGATCAGGTGCCACTGGGGTCTTTACC
AATTCATCCTGGCTCTGGAACAAACTCTTCGAGGCCAGCATTGAAACAGGGGACCGTGTC
TGG


invisible?    
Gene introns: 0  

>19817 223 2476     1q41    chr1:219476076-219476298 BLAT!
CTTTCCCTTTTTCACCTCCAATCTTTGTCTGGGATGCCCACTTTTTCACATCCTTCTATT
CTTGATGTTTTTCTCCTCTTTGAAGATCTTCTAGGTCATTCCAGCTCACAGGAATTCCTC
TGCTTCCTCTAAATGCCTAATGCATTACATGCATTAGCCATTCACCATTCGTTGGTGGGA
TCTTTGAGATCTTTCTTGATATGCTGTCATGTTTTATTATTAT


invisible?    
Gene introns: 0  

>31807 258 2475     18q12.2    chr18:34731635-34731378 BLAT!
TACTGAATTGCTTGGCACCACCGTCAAAAAACAGTTGAGCATATGAGTGTGTGGGTCTGT
TTCTGGACTCCATTCTTTTCCATCGATCTATTTATGCATCTTAAGGTGAATACCAACCTG
TATTGATTACATAACTTTAATTTACATACCTAAAATTAGGTAGCATAAGTCCTTCAATTT
AGTCTTCTAGAATAACAAAGACTGTCACTGCTATTCTAGTCCTTTCACATTTCCATATAA
ATTTCAGAATAAGTTTGC


invisible?    
Gene introns: KIAA1328 (34409079 - 34805288)  

>15650 333 2464     8q12.3    chr8:65934775-65935107 BLAT!
CCAAAAGTAATAAAAACAAAAATAAACAAGTAGGACGACATCAAACTAAAAAGCTTTTGC
ACAGCAAAGTCAACAATTAACAAAATGAAAAGGCAGCCCATGGATTCGGAGGAAATATTT
GCAAACCATGTATCTGATAAGGGGTTAATATCTAAAACACATAAGAATCTCAAACAACTT
ATAATTAGAAAACAAATAATCCAATTAAAAAATGGACAAAGGACCTGAAGAGACATTTTT
CCAAAGAAGACATGCAAATGGCCAACAAGTATATTGAAAAGCGCCTAACATCACTAATCT
TTTGGAAAATGTCAATCAAAACCACAATGAGAT


invisible?    
Gene introns: 0  

>29855 217 2461     14q21.3    chr14:49370220-49370004 BLAT!
ATTTTTTTTCACCCCCTCCCAAACTTATATGTGCCGCAAGAGGGAGGATTTTAATGAAAG
CGTCTTTTCAGCCTTAGCTATTTCATCCAGCCTGACACTAGACTACTCGTTATTGGCAAG
TTCAAACATTTTAAATCATGAAAGATTTACATGAGTGATGTAAGGTTTGAAATGTTTTAT
GGCATGTTCATTCACACTAAATCAGCCGTTGCCTTTT


invisible?    
Gene introns: 0  

>21831 212 2446     12q12    chr12:39438137-39438348 BLAT!
GGAATGGTATCTATCCCCCAGGAAAAGACTTCCAGAACTTCCCAACCATTGTGTGCCATG
AATGGGTTATGGGTAGTGTGGCCATATAACTTGTTGTTCAAATCTAAAGACTTTTGAGAG
TGAAGGAGAGTGTTATTAATAACTATTCTGGGACAACAGGTATAAACAGACTGTCACAGG
CAAACGTGCAAGTATAGACTTGCTAGTCATGT


invisible?    
Gene introns: 0  

>17256 391 2441     12p13.31    chr12:8789673-8789282 BLAT!
TGGCGGCACCCACAGGAAAGCCAAAGCTTGTGGTCAGGGAATCCAGCTTCTTCGGGTCAA
CTCCTTCCTGGAGGATTCGGATGACTTCAGACATCATGGGCGCAAGACACCTGGTAGTAT
AGAAGCCAGGTCCATCCTTAACCACAATGATGACCTTCCCCTGCTTGAGACCAACTGCTA
CAGCTGAAGCACTGGTGTCTTTGGAAGTTTTCTCGGTCGTGATAATCTCCAGCAGCTGCA
TCTTGTCCACGGGAGAGAAGTAGTGCATGCCAATCACCTTCTCAGGTCTTTTGCTGACAG
CAGCGATTTCACTGATTGGGAGAGCAGATGTGTTACTGGCAAAGATACAGTGATCTGGAA
TCACCGCTTCTACTTCCTTTAGCACTCTGTG


invisible?    
Gene introns: 0  

>28195 226 2436     4q31.21    chr4:144143329-144143554 BLAT!
AAAAGCAATTAGACTTGTGCAGCTTTATCTATGAATATCAGGTCTCTCAAGGATTTTATG
TATCAAGATAATATGTATTGACTTTTTTAAATGATAAAATGAATTCTAGTTAGAGTCTTT
CCTTGGTATCTGCAGTGGATTGGTTCCAGAACACCATCCCCCAATATTAAAATCCACAGA
TACTCAAGTCCCTTATTTATATAAAATAGCACAGTATTTGCATATA


invisible?    
Gene introns: 0  

>4802 321 2407     2q36.3    chr2:226998356-226998676 BLAT!
CTTCCTGTGTAATTCAGATCTCTCTCTTTAGTGTGCTCCTATTAGTGGTCAAGCCTAGTC
ACTGAGAGGAGGCAGGAAAAAAGAAACATCATCCTCGTTTCTCCATCTTCCCATCTCTGT
CCTCTACATGCTACGTTTTGCAGGTAGATTCCTGAAGAGCTACTGGCATCACGTTCAATC
TAATTTCTTGTTGCTAACATTTGAAATCATCTTCTAGATGTAGATAGATCAGAACTCAAA
ATCTAGCACTTCATGGTCTCTCTCTAATGCTGTCTTATCACCAAGACAATCAACTTCATA
AAAATGGTCCACCCAAAACAG


invisible?    
Gene introns: 0  

>15549 317 2405     2q31.3    chr2:181655938-181656254 BLAT!
CAGTCAAATGTCTGCCACATCTCATTGATCAGTATTGAATTAAAACCTTTTATTGAGACA
TTCAATAAATTCTTATTAAATAAATTCATGGAAATTCCAACAGCTCTAAAATTAGAGTTT
AAAAAATGTTGTGCCAGAACTCAGGAACAATATTATATTACCAAAATGTATTTGAGCAAA
TGAGCAGAGCAAGAAAAGTAAATTATAGAAAGAGATTTCCATCTATCTCACTGCACACAT
GGAGACTTAGCTGTTCAGAGACCTAGTAGCCATTTTTATTACCATCTTGTCTCTTTTCCC
CAGTTAGTGTATCTTTT


invisible?    
Gene introns: 0  

>13784 291 2401     11q22.1    chr11:101250928-101250638 BLAT!
GTGAATAGAATGAACAGAAATGTAAGGTTTAATATGCCAAAGCTGAATTTCAGCTCAATC
CCACTTCTACCCAACACATGAAAGAACAATCCTGATTCACCTATAATGTTCCCATTGTAG
CTGCTGTGACTCTGTATAATTTTAGTTGCCGAGGCGATAAACCTTGAAATTGTCTTTGAC
TTCTCTTTTTGCACATGTCCCACAGACAATCTGTCTGGAATATATATCACAAAATATATC
TGGAATCTGATCACTTCTTATCACAGATCCTGCTACTATCCATGTGTGAGG


invisible?    
Gene introns: 0  

>5502 125 2397     6p12.3    chr6:47111708-47111814 BLAT!
AGCGTGGTCGCGGCCGAGGTACTGGTCCTCAGTGGGTTCTTATTATCAGGAAACTCAGAT
TATTCTGTTGTGGTATGTTTACTGGTGTCATTTTAATACTCTTCTCCCCTTGGTATTTTG
TTTTC


invisible?    
Gene introns: 0  

>12278 124 2396     5q12.1    chr5:60735529-60735406 BLAT!
ATCAAGAACACTCTTAGCATCATTGTTAATGATAGCCAAAAACTGGAAGCAACAGTAATG
TCCACCAACAGTAGAACAAATAAAGTATGCTACAGTAATGATGATGCTACAAGCAACACA
GATG


invisible?    
Gene introns: ZSWIM6 (60628099 - 60841999)  

>16381 250 2396     3q13.32    chr3:117388738-117388987 BLAT!
GGGGAGGAGTGAGCTAGACGCATGATAGCTCTTTTCAACTGAAAGGTGTATTTACAAGCC
TGAAATGAGCACCTTTCAACCCTGGGCCTCCTCCCACTCCCACTTTTGGAGCTATGAGTA
GGGGAAACCCATATATTATATCTCAGGCATGTGAGCTGACTGTGAAAAGGGCAGGGCTGA
TTTACTTCCATTGTGTGGAACACAAGCTCTGCTGGCATCTGTCGTTCATTGCAAAAGCTG
AGCTTTCAGA


invisible?    
Gene introns: 0  

>13856 245 2395     Xq27.3    chrX:143316294-143316050 BLAT!
AACTCACTATCACGAAGACAACATCAAGCCACGAGGGACCTGCCCCCATCGTCCAAACAC
CTCCCACCAGGCCTCGCATCCAGCATTGGAAATTACAATTCAACATGAGATTTTGGTGGG
GACAAATATTCAAACAATGTTATGAGGTCAACGTGAACTACCCTGGGCCATAAGAATAGG
CACACTCAACCCACCACTGACACTCCTGAGGCCTGAAGACAGGCAAGCCTAGCATCCTAG
TCCCC


invisible?    
Gene introns: 0  

>23492 103 2394     3p14.1    chr3:65035327-65035428 BLAT!
CTACATGAGAGCAGAAATTTTGCCTCTATCGTTCACCAGTGTATAACCAGAACCCAGAAC
ATACCTGACATTTGTTAAATGTTCAGTATATATTGAATGTACC


invisible?    
Gene introns: 0  

>24813 130 2389     4p15.2    chr4:23455293-23455182 BLAT!
GAGCGGCCGCCCGGGCAGGTACTAATGCTGGTGTCTAGTTTTGACAAAGTAAGATAATGT
AAAATGGTAGTATTAGGAAAATTGAAGCTGGGTAAGTGGTATAAAGATTTAACTCTGAAC
TATCTTTGCA


invisible?    
Gene introns: 0  

>16188 241 2387     14q21.3    chr14:49370282-49370522 BLAT!
AAGGAAATTTCTATAGAGTTTCATTAAGATTACAAGGGCAAATAATGTCTTCACCAATGA
GATGGGGGATGGTTTTGATATTCAAATTCTGTCTATAGTCAAATCAATTTAGTAAAGAAT
GGGTGATTTAGTCAAGTAACTGATTAAAAAAATTACTTATATACTGGGAATTTGGTTTTA
CTAAATCAGCCTTATTGTTTTTCAAAGTGAACCCATCATAGACATTCACTTAGGCAGTGG
C


invisible?    
Gene introns: 0  

>556 163 2371     21q21.3    chr21:27751183-27751345 BLAT!
TGCAATGAAGCAAGTCGTGGAAATTTTTTGGTCTCCCAATGCAAATAAAAGTTGTGTTTA
CACTATGCTATTGTCTATTAAGTGTGCAATAGCATTATGTCTAAAAAATATGCATACTCA
GCTGGGCATGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGA


invisible?    
Gene introns: 0  

>22454 279 2345     16q22.3    chr16:73479684-73479962 BLAT!
GGGAGCAGGTGTCCAAATGCACAGCAGGGTTAGTGTGTAAATAAAATACACCAGCTCCCT
TTCCCCTGAGGTGGAATAACTGTGAGGTGTGAGTTCTACACTCTTCCATGAGTTCTGTCT
TGAAATGAAGTTCCTGTTGCCCACAGTTGAAACTTGCTGGATAATGTTCTCTTTATGATC
ATCCTTCTCTTTTCTTGTTTGTTCTTATGCTTCTCTCAGTTCCTGGGATCACCTTACAAA
TAAATGAATTTTACTTGAATACTTTCCTGAGGATCTGTT


invisible?    
Gene introns: 0  

>11634 276 2341     16q21    chr16:59985763-59986038 BLAT!
TTGAGCCTAGGAGTTCGAGGCTGCAGTGAGCCTGGGTTAGAGGGTGAGACCCTGTGTCAA
TAAATGAATAAGTAAATATAGATAAATATTAATTATGCATTCTGAGAAGCATTTAATACC
AATGGTTTGTCAAAGTAAAGCAGAGTCCCAAGAAGTAGATGCCATTTGGCTTCATAAAGC
GTATTTTTTTCCAATAAATGAATAAAGTTATTCAAATATTTACTGAATGCCTATTTTGTG
ACAGGCACTATTTGGACTAGAGATAACTCATGAGTA


invisible?    
Gene introns: 0  

>30269 204 2324     5p15.1    chr5:16625101-16625304 BLAT!
GGGGACCTGGGGGTGGGGCCGAATGTTCCAACCTTGTAATCACAAGGTCAGTTCCTCGGG
CCACCAGCCCCCATCATGAAACCATCTAGGGACCAAGGAAGAATCGTAAGTGTAAACTCA
AGAATAGTTGACAGGGACTTATGAAAAATAAATGATGCTCTTCTCATCTCTGTCACTCAG
GAAATTCCAAGGGTTTTCAAAGCT


invisible?    
Gene introns: 0  

>14354 196 2321     4q24    chr4:101836836-101836641 BLAT!
CAATTCCCCCTAGGGGAAAATATAGGGTCTCAGTCCACTTTTGCCGCTGAAATATAATGT
CTGATACTGAGTAATTTATAAAGAACAGCTCACACCTTTAATCCCAGCACGTTGATCGGC
TGAAGTGAGAGGATCACTTTTGAGCTCAGGTGCTTGAGACCAGCCTGAGCAACATAGAGA
GACTCTGTCTCTACAA


invisible?    
Gene introns: 0  

>13743 239 2317     4q22.1    chr4:92515140-92515378 BLAT!
TATAATGTGCACAGTCGACTGATTAATCACTAGATTTTCCATCCTTTCATCCTCATTAGG
AATTCTATGGATAGGTAATAAGCTAGCTGCATGACAACTAAATTGCGCAGAATCTGACAT
AATTACATGAGTTTCAGGAGGCTTAATTCTGATTTTGAGAAAGATGTGGCTAGACACATG
CATTAAAATTACCTTCAGGGATCTCAAATTCTTCAGAGGTAATAAACATTGGTTAACAT


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>4130 187 2308     21q21.3    chr21:27751155-27751341 BLAT!
TTCCAGCCCACCACAATAAAGCGGGTGTTGCAATGAAGCAAGTCGTGGAAATTTTTTGGT
CTCCCAATGCAAATAAAAGTTGTGTTTACACTATGCTATTGTCTATTAAGTGTGCAATAG
CATTATGTCTAAAAAATATGCATACTCAGCTGGGCATGGTGGCTCATGCCTGTAATCCCA
GCACTTT


invisible?    
Gene introns: 0  

>8727 223 2294     5p13.2    chr5:34476030-34475808 BLAT!
GCCAGCATAAACAAAAGAGTAGTCCTGGGGTGCTGGGAGGAGAAGACATCTGTGCCTTGG
GTCCTAAGAGTGCTCTGAGGATGTGAAAGGACCCAGAAGGACAGCAGAGAGGCCTGTCCT
ATGTTCCTTGGTCCCCAACCTTGCCAAGGTGCTCAGGTTCCAAACCTGACACTAAAGCAA
GACAGCCGTAGGCCAGATGAGGTCATGGGAGCAGGAACAATGA


invisible?    
Gene introns: 0  

>22901 218 2290     5q34    chr5:160609090-160609307 BLAT!
AGAATCATTAGAGATTACTATGCACAACTATATGCCAAAAATTGAAAAACCTAGAAGAAA
TAGATAAATTCCTAGATACATATAACTACAAAGATTGAAGAACAAAGAAATCCAAAACCT
GAATAGACAAATAAGTAATGAGGTCAAAGCCATTGTAACAAGTCTCCAAGCAAAGAAAAA
CCTGCAACCCAATGGCTTCACTGCTGAATTTAACCAAA


invisible?    
Gene introns: 0  

>9836 274 2289     2q31.3    chr2:181747643-181747370 BLAT!
GATTTCAGAATGGCACCAAGCTGCAGTTTCTCAGGGCTCAAAAGCCTATGGGCATCTGCA
GGAGTTCCCTCTCTGGAACAACGCCTCTGTGTAATCTCTAGGTTACTCCCTGTGTCAGTT
TTGACACATGTTTCAAGGGGTTCTCTCATGGCTAAGACTGTAAAAGACTATAATGCAAGT
ATGGAATGCTGAGGATATATCTCTTACCCTTTCCCCATGTCTGGGAGCTTCCCTCAGTTC
CCAACCAATCCCAGCCAAGAAGGATTTCTCACCT


invisible?    
Gene introns: 0  

>29548 357 2287     6p24.3    chr6:7516689-7517014 BLAT!
GGCAATAACTGTATATATAAGAAAAAGGCTGTAAACTTATAGAAAAGATAAACTCTGGCT
TCTAAACAAATTACAAAATTGATTTTGCCTTTATCCTTGAGTGTAACACAGAAAAATGTA
AACCTGTAGACCTAGTTACCAAAAGACAATTATCCTTCTTAGCTCAGGTATGAACTTAAA
GTTTGGCCTGAGCTAGTTTGATCTTCAAGTTTTCTCCAAGTTTATCCATGAACTCAAATG
TATTCAAGTAGTCAGAACGTTGCACATTGGGTAAACCTTTAATGCAAGCAGCCAAGTCCT
TGGTCATGAAGCCAGCCTCAATTGTCTCAATAGAGACTTCTTCCAAAGCATTTGCAA


invisible?    
Gene introns: 0  

>29430 248 2283     5q13.1    chr5:67377788-67377541 BLAT!
TTTTTTGTATTTTTAGTAGAGATGGGGTTTCTCCATGTTTGTCAGGCTGGTCTCAAACTC
CCAACCTCAGGTGATCTTCCCACCTTGGTCTCCCAAAGAAGACTTTCATTTCTTAAGTGA
TTTAACATATTGATACTTTGACGTGACACCATGGAAATAACATATGGCATCAGTCTTCTA
GCCTCAAGGGCTAGAAGAAGATGCTCAGATCAACCCAAGGTCAAAAGACATTTTATTGCT
CTGAAGAA


invisible?    
Gene introns: 0  

Shown 271-300 from 3142 sequences on 10 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs