Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 3031-3060 from 3142 sequences on 102 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>32910 101 162     5q14.1    chr5:79628091-79627991 BLAT!
AATTCTGGCCGTCGACAATTTTAATGGGATCAAGATCAAAGGAAGAACTATCCGAGTGGA
TCATGTGTCTAACTATCGGGCTCCTAAGGACTCAGAAGAAA


invisible?    
Gene introns: 0  

>4462 106 161     7p21.1    chr7:17098726-17098621 BLAT!
TAATAGGCTTAGTGACTGATCACTGAGCAGGTATAGAAACAGATTCAAATACATTTAATA
ACTGGGTATCAGGAATAAACAAGCTTTAAATTCTCTATCTCTTAAG


invisible?    
Gene introns: 0  

>4494 117 161     8p12    chr8:34930016-34930132 BLAT!
GCCTACTAGCAAAACTTAATACTGTATTAGCCTTTTTATGCAGATGTATCACATTGTTGA
TTTTTATTGTGTTCACAGTTAACTAGAAACATCAGATACTTTACACATGAATTTCTA


invisible?    
Gene introns: 0  

>9201 104 161     Xp11.21    chrX:57250809-57250912 BLAT!
ATGTCATGCCTGAAGTAATTATTGAGTAAGTGGTCCCTTTTCCCTTTTCTCTAACCAAAT
AGACAGGAATGTAAGATTCTCCCGGGGCCTGAAAGCTTAAGGAG


invisible?    
Gene introns: 0  

>13601 105 161     5q21.2    chr5:102835137-102835033 BLAT!
GATGAATAGATTGAGTTTCTGAGCAGCTTTGCTATTATATTGCAAAGAGGCCACGCAGCA
GCCTGGCTGAATGTGTGAGGAAATCGCGTCCTGGAAATGAAAAGG


invisible?    
Gene introns: 0  

>18891 106 161     16p11.2    chr16:32785491-32785596 BLAT!
TCAGGAGTTTGAAACCAGCCTGGCCAACATAGTGAAATCCTGTCTCTACTAAAAATCCAA
GAAAAATGAGCCGGGCTTGGTGGTGGGTGCCTGTAATCCCAGCTAC


invisible?    
Gene introns: 0  

>32269 100 161     6q14.1    chr6:80047025-80046926 BLAT!
GAGGCTTCTGTTTGCTGAATTGCATGCTGTCTTCTTCTTGGTCAGTTTGCCCCTAATTTT
ATTGGTTACATCCTCAAGGGCAATTACATTTTTAACTTCT


invisible?    
Gene introns: 0  

>32869 108 161     5p15.1    chr5:18189372-18189479 BLAT!
TGATGTAACTTCAGTCTTTAAGTTTGTTAAGATTTGTTGTGTAGCCTAACTTATGATCTA
TTCTGGATAATGTTCTGTTCATACTTGAGAAGAATGTGCTGCTATTGG


invisible?    
Gene introns: 0  

>11587 102 160     3p26.3    chr3:916848-916949 BLAT!
ACAAAGTGCTGGGATTACAGGCAGGAGCCACTGTTACTCAGTAATGCGATGGCTGGGTCA
AATGGTATTATTTCTAGTTCTAGATCCCTGAGGAATCGCCAC


invisible?    
Gene introns: 0  

>13339 106 160     2q32.1    chr2:184978483-184978588 BLAT!
CTCTCCCAGAAATAAAAGTTGACAACATGTGTAAGGTTTTGCCAACCTGGGAAGTTCACA
GGAGTCTTTCTTCAGGATTACTACTGGAAGTTAATCACCTAAGCAT


invisible?    
Gene introns: 0  

>19197 109 160     1q24.3    chr1:171115535-171115427 BLAT!
CTAAGAAGCTGGGACATTTCTTTATACCGGAAACCAGGGTCTTTAAGAAAACTAGAAAAT
TTATTTTTCCATTTATAATTCTACATGTGAAAGTTTTTTTCCTTCTTGC


invisible?    
Gene introns: FMO6P (171106878 - 171130702)  

>30234 110 160     8q24.23    chr8:138063629-138063520 BLAT!
GGCACCAACCATGGAAGGACGTCATTTCATCACAGGGTTCGCTTACACCAACACCCACAC
TCACTCAGACTGTGACAGTGTAGAAACGCCAACTCACAGAACATACACAG


invisible?    
Gene introns: 0  

>4441 112 159     4p15.2    chr4:24068734-24068623 BLAT!
ATTTTAGTTTTATCAAGAAGATAAATTGTTCTGCCTAATGAACGTATAGATATTCTATGC
CAAAGACATTTGGAGTAATCTGTTAATCATTTAACTGTGTCAGGGCATATGC


invisible?    
Gene introns: 0  

>18766 115 159     6q14.1    chr6:79319675-79319789 BLAT!
TACATCAGGAAACTGAGAAATTAGACCACCTCTTCATTTTCTTTGAAACCTAGTTGGCAT
ATTGATCTGTGTTGGGCTGCAGGTTTAAAAAGGAGCCATACACCAACTAGGACTG


invisible?    
Gene introns: 0  

>29601 113 159     6q15    chr6:91882961-91883073 BLAT!
ACTATGCTCAGAAATCTCAGGGCAGCCCAAAGAAAAGAAAGGCAATTATTTCAGCTGTGG
GCAACCATTGGGCAAGGCTTATAGCAGCTCTGGGGGAGGCCATTCCCAGTCAC


invisible?    
Gene introns: 0  

>31270 108 159     16q21    chr16:63076318-63076425 BLAT!
GGCCACACAAAAGAAAGGATGTTCTTCAAAAAAATAAATAAATGTAAAGTATCATAAAAG
AAGTGGTTATATGTATATCCTGCTGCCTACAGGTTGAATAAGTTGCAT


invisible?    
Gene introns: 0  

>5402 102 158     11p12    chr11:42346125-42346226 BLAT!
TAAAACTTCCACTTTTGGTTAATTAAGGATTAGGTAAAGGTAGAAAGAGATGTATTAGTT
TGTGCAATAGCTCTAATTTTTGAATGATATTGGGGAAATGGT


invisible?    
Gene introns: 0  

>6205 102 158     8q13.3    chr8:73115896-73115997 BLAT!
TTTTTCTCTGCTAGTTTTGAATAAACCCCCCTGTCATCTGGAGCAATCTAGTCACCCACT
AACATGAATGATCCTTCCAGGCAAGGGGGCCTTGGGCCAGTG


invisible?    
Gene introns: 0  

>18090 114 158     1p34.3    chr1:38990736-38990647 BLAT!
GCGTGGTCGCGGCCGAGGTACATGCCATCACACCTGGCTCATTTTTGTATTTTTAGTAGA
GATGAGGTTTCACCGTGTTGGCCAGGATGGTCTCGATCTCTTGACCTCGTGATC


invisible?    
Gene introns: 0  

>23937 100 158     8p23.2    chr8:5540278-5540179 BLAT!
ATTTGGAAGCTATTTAAATCCTACCAGTTGCCACAGCTGAAAAACTGTGAGAGAAAGTGA
TGTGAATATGCAGGAAGGGCATTGACTGTGGCCCATGAGT


invisible?    
Gene introns: 0  

>24396 103 158     2q22.1    chr2:140572487-140572589 BLAT!
AATCTACAAAGTGTTCTATATGACAGTATCAAAAAATAGAGATACATTAGAGTGAGGATG
TTAGGAGCAAGGGCTTCTGATCCAAACCATGGAGATCAGCTGT


invisible?    
Gene introns: 0  

>30038 101 158     12q24.21    chr12:115774450-115774350 BLAT!
CACTTATACTAAATGTTTGACAAAATTTTACAAAAAGTTATGCGTGCCATACAAAAGAAC
AAAGTCATGCCCTTTGCAGCAACATGGATGGAGCTGGAAAC


invisible?    
Gene introns: 0  

>10449 116 157     4p15.33    chr4:11431839-11431933 BLAT!
AGCGTGGTCGCGGCCGAGGTACTTTTGGAAAATAAGCTTTTAGGAGTTGAATGACCTTGT
CTACTTCTTTTAGTCAGAATAATGTTGGCATGTCTATTTTAGGTTAAAAAAAAATA


invisible?    
Gene introns: 0  

>19176 101 157     4q22.1    chr4:90318310-90318410 BLAT!
GTGATAATTTTTCTTTTAAAATGATAATACAGTATTCTATAATTTGTCATTAATTTTAAT
TCAAACTTGCTTATATCTAAGACACTCAACAATTTGTATAC


invisible?    
Gene introns: 0  

>24086 114 157     11p14.3    chr11:23620089-23619976 BLAT!
AAGGGAGGGCTCAGAAGAGTGCATATCATATGCTAGCCTGTGTGGGGAGCAAATAAGAAT
ATATAGTCACATTTTCTTGTATTTGCATAAAGTCACCGTGGACTAATGTGCAAA


invisible?    
Gene introns: 0  

>7230 112 156     18q23    chr18:76109503-76109392 BLAT!
TAAGTCTCTGCTGCCTGAGGAAGTGTCAAGTGTTGAGGAGAGAAGGGGTTAGCAACAAAA
CTCAGTCTGGGATGGCAGGTGGGGGCAGAATGGCTGTGTGGACCTGCACAGG


invisible?    
Gene introns: 0  

>10564 108 156     Xp21.2    chrX:29458767-29458660 BLAT!
GTGTTTCAAATGTCATTCTCCTGAATGCTTGCAAACACAAACAATTTTTAATATGGCTTA
TCATTTTTCTTGATCTTGAACTAAGAAAACTATTAATGAGGTAGCTCC


invisible?    
Gene introns: IL1RAPL1 (28605680 - 29974017)  

>22204 112 156     8q12.3    chr8:63776056-63775992 BLAT!
ATAGGGAGAGGAAGGCGATATTTACATCCCACTCTGCACAACTCAGTACGTTGTGTGAAG
AGTATCATTCGACAGGTCCTTCAAGGGTTAGATTACTTACACAGTAAGTGCA


invisible?    
Gene introns: NKAIN3 (63161500 - 63903628)  

>31576 107 156     2p23.1    chr2:31491649-31491543 BLAT!
GCTTGAAGAAAGGTGTGGAGTTGAGAAATGGTCCCTAACCTGCACTCGGCACTCAAGGGT
TTTCTCCAGAGCAGGTGAGACCTCTTTGCCTGGCCTTTGTCTGCCCT


invisible?    
Gene introns: 0  

>7338 101 155     20q11.22    chr20:32553113-32553013 BLAT!
AGCCAAGATTCAGGAATAAAGGCCCACACGAGGTAAAGTATGAAGCCAAATTGGGAGCTT
AAGAAAAGAACAAAGCCATAAATCGCTCTTTCTGGCAATGG


invisible?    
Gene introns: 0  

Shown 3031-3060 from 3142 sequences on 102 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs