Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 331-360 from 3142 sequences on 12 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>17487 236 2098     18p11.31    chr18:4498044-4497809 BLAT!
TGCTGGTTAATCCCATCATGGATGAATGACTTAAAAGAGAATGAGTTTTTAAAGCATGAA
GGCAAAGAGAGTGATGGAAATAAATGTGAGTAGTAATACTGGTGGTGTTTAAATCAGTCA
TGTATCTTCAAAGAGTTATGAGGACAAAGTAAATCAGTTACTTTGTGTTTTTTATAGCTA
TCATCTACAAATAAAACTAAAATGTCATTAAAATGTATCGAAATATTTTATGCTTC


invisible?    
Gene introns: 0  

>26192 234 2077     6_apd_hap10    chr6_apd_hap1:2808462-2808695 BLAT!
CAATGCAGAGTGATATCCAGATAGCGAGCTGGCTAGCAGCTGTCCACTCTCCAGCAATCC
TGCCTTCTGGGGCATGGTTTTCTAAGGACCTTCCTGTTCCTAGATGATCAAAATTGGGAC
CAGCCACTCCCTTCTGAGCCACTCCTGCCTCTGGGCCTGTGGCTATGTCACAGTCCAGTC
ACAACAGGACATCCCTTCAGAACACCCTGCAGGAAGCTGACATCTCTATGCAGA


invisible?    
Gene introns: 0  

>31660 222 2076     7p12.3    chr7:48943128-48943275 BLAT!
GGAAGGAACCTTGTAGATTTTTCCACCCTTATAGACAAAGCTCCCTTCAGTCACTTTAAA
ATCCAGATAGCGAGTTACCTCTGTATAAAGCAGCATCTTAACCAGCTGACCATTAGCCAT
AAGGAACTTGGGAATCAAGTCAACATTCCAGCCCCGCGTACGCGGGGCAACAAAGAAATG
CAAATCAAAACTACAATGAAACATCATCTTACACCAGTCAAA


invisible?    
Gene introns: 0  

>17766 242 2061     12q21.2    chr12:78017003-78016762 BLAT!
TATAAAAAATCAATTTTTTTTCAGTTACAGAAAAATATTATATTTTAATTTGCAAAGGAC
ATATTCATGCTCTTACAAATGTGTTCTAGTTTACAGTCCATCCTATACCAAGACATCCAA
AACAGACACTGATGATTCACTTCTATCACTTGATGTTTAGCAAGTCACACTTCTGTCAAC
ATGGTTTGGTATCCATCACTTTCTAATGTGACACTGTCTAACAAAAGATTGTATTACAGG
TA


invisible?    
Gene introns: 0  

>14344 237 2059     1q24.1    chr1:166530716-166530480 BLAT!
GCTGGCTCTTGTTTTGAGGAGCATATTCTATATCACATTAAAGAAATATTCTTATCTTTC
TAGATAGCTTTGTATGCATGTATGCTTGTGTGTATGTGTGTGTGTAATCAGAAAATACTA
TTGATTTATTGACTGCATTCTTGAAATCTATTAAGATAATAATATGGTTTCCTCATTTCA
TATATTTCTGTGATGGATGATATTAGCAGATTTTCTATTTGAACTATATTTATATTT


invisible?    
Gene introns: 0  

>27187 365 2058     9q31.1    chr9:107748746-107748410 BLAT!
AGCGTGGTCGCGGCCGAGGTCGGCCGAGGTACCACAGTTAGCAAGTGGTGATACCAAAGT
TCAAATACAGGCACATGTATATTCTAACTAATAACTATTGTGGTCTCTGCAACTATAGCT
GGCGTTACTCTGCACTGCCAAGCTGATGCAAGACTCCCTGTCCTCTGGGTGTAGGCACAA
TTTTAAGCTTATTGACCACCGACTGTGGAAGAGGTTCCAACAGGCCAGGAAGTTATCAGG
AGGGGAGGAAGTGGAGAAGTAGCTTCAAGCCTGGAGGCTTTCTGCCCATGGAGCATGTCC
AGTGTGGCCAAGGAAGACATTGTCTTCCCTGGCTGTTTGTTCTCTAAGCTAGAAATTATC
TTAAG


invisible?    
Gene introns: 0  

>13353 208 2057     4p15.32    chr4:16972179-16971968 BLAT!
ATGTAAATAAAATAAATATAATTATGGTAAATCTTAAAAAGTGTGTGCAATTCATGAGTT
TTGGCAGTGGCATACACCCACAAAAGTGCCACCACAATCAGGATTCAGAACATGTTTATC
ATCCCTCAGAAATCCTCAAGCCCCTTTTCAGTTGATTCTGCCCCACTCTCTCCCTCCTCG
GGCCTCAGGCAAACACTGAACTGCTTTT


invisible?    
Gene introns: 0  

>33265 297 2057     4q28.1    chr4:124063992-124064288 BLAT!
GGGGATCAGAAGAGATAATTTATACGAATCATTTGGCTTACAATTTGTTGTAAAGTGAGG
CCTTGAGACGCAATAGCTATTACAGGGTGAGCATTCTAAGTTGGAAAATTCAAGACCTGA
AATGCTCCAAAATTTGAAACTTTTGAGTTCTAACATAATGCTTGAAGGAAATGCTCATTG
GAGCATTTAGGATTTTGGATTTTAAGGTTTGGGATGCTCAACCCTAAACCAGTAAGTATG
TATAATGCAAATATTACAAAATCCAAAAAAAATCTGAAATCTGAAACACTCTGGTCC


invisible?    
Gene introns: SPATA5 (123844224 - 124240604)  

>30905 226 2030     8q24.13    chr8:124301466-124301657 BLAT!
GAGTAAAATAGATTCAGAAGGAGGAGTTTCAGCAAATCATACTAGTCGTGCAACGTCTAC
AGCAACATCAGGATTTGCTGGAGCTATTGGCCAGAAACTCCCTCCATTTTCTTATGCTTA
TACGGAACTGGAAGCTATTATGTATGCCCTTGGAGTGGGAGCGTCAATCAAGGATCCAAA
AGATTTGAAATTTATTTATGAAGGAAGTTCTGATTTCTCCTGTTTG


invisible?    
Gene introns: 0  

>23939 229 2012     4q24    chr4:101837784-101838012 BLAT!
CCATTGCCAAGGCTTGAGTAGGTAAACAAAGCAGCCAGGAAGCTCGAACTGGGTGGAACC
CACCACAGCTCAAGGAGGCCTGCCTGCCTCTGTAGACTCCACCTCTGGGGGCAGGGCATT
GCCAAACAAAAGGCAGCAGAATCCTCTGCAGACTTAAATGTCCGTGTCTGACAGCTTTGA
AGAGAGTAATGGTCCTCCCAGCATGCAGCTGGAGATCTGAGAATGGACA


invisible?    
Gene introns: 0  

>15016 263 2008     4q34.1    chr4:175445387-175445125 BLAT!
AATATTGTCCTGAAAAATTCAAAATATTTCTCCATCCTTTATTCCCTGGTGCTCACCTGA
GTATTTTGCATTATTAACTACTTCTTTCTTCTTGAAAGTATTTCTCCCACAAGAGCTGCA
AACCTGTGTTCTCCCAGCATGTTGCCATTTCACCCCAGCAGTTCCTTTTCTGTCTTTTTT
GCCAGTTCCTTCATCAGAAACTTCTATGTTCTGTGCATGCCATTAGAGGAGCTGAAGTTT
TGTTTGGTTCCTTGTTTTCTTTT


invisible?    
Gene introns: 0  

>12998 204 2000     16q23.1    chr16:76969041-76968838 BLAT!
GAAGGAATACAACCCTCTTTGCCAGCGCCCACAGGAAAATCAGACTTTGGATCCTACATA
TACTTTCCTCCTCACTTTGTTTTTCACATCCTCTGTTCTCTCTGCTTCAAAAAGCCTGGA
ATTTTGTCAGTTATCATTGACTTAGTATGTCTCTGCCAAAAAGCTTTACACAAACTATTC
CTTCTGCCGGGAACATCTTTCCCT


invisible?    
Gene introns: 0  

>4686 202 1994     14q21.1    chr14:41636014-41636215 BLAT!
ACGCTGGTATCATAGTCTTCACCTTTATTTTAAGCCAGTATATACATGAGGAGTCAGGCT
CCAAATCACAATCCTATGTGTGATCTCTCAGGCCCAACCGTTGATAATTTCAAGACGTTG
GGTGGCAAGACTATTTAAGGAAATCTGTCCTCCATACACAAATTTGGTGCACAGCCAGTC
CATTGCAGTTTTCTGGAGAAAG


invisible?    
Gene introns: 0  

>5417 256 1985     11p13    chr11:34426268-34426498 BLAT!
CTTCACGCCTCTGACCACCTCCTGAGCCTCGAGTGCTATCAAATTCCTGAAGCTCTACCT
CCTCTGTTTCTCCAATTATGTTAGGAACTTCCGGTCTAGATGGCAGAAGATCTTCTAGTT
CAGAAAGCTTGTCTGGGTTGATCCAGTTGTTTTCAGGAAACTGCACATCAAACTTTATGT
AAAGATCACCTTTTTCAAAGGGATTACGATACTGCGGCATCCCTTCACCTCGAACTACAC
GAACACACCCTGGTTC


invisible?    
Gene introns: 0  

>8448 253 1985     22q12.1    chr22:28580200-28579948 BLAT!
ATTAAATACTTGCTATGTGTCAGACACAATTCTAAGCTCTTTAAATGTGTGGTCATAATA
AGCCCATAAGGTGGATATCATTACCCCCATTTTATAGATAAGGAAACAGAGACAGAGAGA
GTAACTTCCTTAATTAAGGGAAAGTAGCCAGTAGACACAGGATTCAAACCTAGGCAGTTT
TAATCACTGTATTACCTTATGGTTGCTAAGTCCATTATTATGCAGGGAACAGAATCAGTA
GTTGTTAGAAAAG


invisible?    
Gene introns: TTC28 (28374001 - 29075853)  

>26482 344 1982     2q14.2    chr2:119480486-119480143 BLAT!
TCCCTGCCTCACTCTGCAACTTGCTTTTTTCACTTCATTTTTTCATGTTGTATAATTTGT
ATTTTGGTGGACCTCAGCTCCCCTGCTTTATTCTAGGCCAGAAGTTGCAAAGCATACTTC
TGCAGGACATTGGGTTTCCTTAAGTTGAACCAAGATGCTGAATTGTTGACATCCAGTAAT
AATCGTCATTGGTTCAGTTTGCAGAAAGTTAAATAAGTATAATTTTTAGCACTTTGACTT
TCTGCCATGACTTTTTATTAAAACATTGGCTCTACCACCATTTGGACTAACTAGGCTCTA
ACCCCAAATGATTTCAAAGTTACTGCAAAATTATACTTAGTTAT


invisible?    
Gene introns: 0  

>19248 455 1979     3p14.1    chr3:67355702-67355248 BLAT!
CTTTAGGTCTCATTTCCAGGTAAAGAGGTTCAAAAGCCCAAAGGGTCATGCAGTTGAGCC
TGCCCCTTTTAAAAGCTGTTTTTGGAAGCTCAGTCCAGTAATGCCTGCATGCATCTTATT
TGCCAGGGTTACTGGGCCACCTCTAACTGCATAGGAGTCTGGTAAAGTAGGTAATTTTAG
CTGGGAGCATTGTTGCCTACACAAAATCAGGATGTTGTTAGTAAGGACAAAGGGGAGAAT
GGGTTGGCTGAGCAATGAGCAATGTCTGCCATACTATCAAAATCCTGCTCTTAGCATTCA
AATTGTTCAATCTGGATGCAAGCCAGGTGGGATGCTCATGGACACATTTTTATTCTTCAC
TTTCCCTTCTATATTTTAAGCACAGATCAACAGAGTGGATAATTCATACAGATTTTCCAT
GGCTGCCTTCATCTACTGTGTGTCCTGTTTCTCTT


invisible?    
Gene introns: 0  

>20851 219 1976     10p11.21    chr10:37058289-37058507 BLAT!
AGAAATTGATACTTTTAGTGACTTCCATAGAGCCTGACATTATCATTTCAAGTCAAGGAC
CCAAAAATCATTTAGCACTAGGCACAGGCACAGGGTGCCCCACTGTCAGAGGGCTGGCAA
CAACGTAGCCTCCATTCAAGGCTCCCACCAAGACTTCAACTTTGTTTACTTGTTTTCAAG
CCTCCACTTCCATGGAACTAAAACCTACCATGGAGATCT


invisible?    
Gene introns: 0  

>12146 139 1974     6q12    chr6:66547338-66547476 BLAT!
CGACTCCTCCCAGACCAAAGACGGCACAAACAGAGCCAGGCTCCAACTTGGCAGTGTTCA
CAGCAGCACCATAACCGGTTGAAATGCCACAACCTAGAAGGCAGACTTTATCCAAAGGTG
CTAAAGGATCTATTTTAGC


invisible?    
Gene introns: 0  

>7902 351 1973     2p23.3    chr2:26251320-26251016 BLAT!
TCCGTATCTGCCCTGTGGAATTCAACCCCAACTTCGTGGCGCGTATGATACCTAAAGTGG
AGTGGTCGGCGTTCCTGGAGGCGGCCGATAACTTGCGTCTGATCCAGGTGCCGAAAGGGC
CGGTTGAGGGATATGAGGAGAATGAGGAGTTTCTGAGGACCATGCACCACCTGCTGCTGG
AGGTGGAAGTGATAGAGGGCACCCTGCAGTGCCCGGAATCTGGACGTATGTTCCCCATCA
GCCGCGGGATCCCCAACATGCTGCTGAGTGAAGAGGAAACTGAGAGTTGATTGTGCCAGG
CGCCAGTTTTTCTTGTTATGACTGTGTATTTTTGTTGATTTATACCCTGTT


invisible?    
Gene introns: 0  

>10629 230 1957     Yq11.221    chrY:15207414-15207226 BLAT!
TCTCTTTGGCGCCTCATTTGTTCTTCCATCTCACGTTGACGAATCATCATCTCTTCCTCT
CTTCTACGTCGTTCCTCCTCTTGCCTCAATTGCATTTCTTTACGTTTCTGCATTTCTTGA
TTGTGAAGTTCTTCCATGCGTCTTAATTCTTCCTGTCGTCTCATCAGATCTTGGCGCAAA
AGATTTGCCTGATGTTCATGATAGGCATCTTCCATTTCACTTTCCAATTT


invisible?    
Gene introns: 0  

>18726 337 1952     11q14.1    chr11:80863795-80864131 BLAT!
TTAATCTCTCTATTTCAGTATGTGTGTTCTGATCAACTCATTGTAGCTATTATTCATCTC
CAGCTATCAATTGGATCACTTGAGGTCATCTCTGTATCTGGAATGGTAAGTCTGGGTAGG
CAAAGTGCCTTTAAGTGAATTCTACACTCAGATATGGGTAAAATGATCTAAAGATTCCTA
AGTCAGTTTGAAAATAGAGGTTGGGATGGAGGGATTTCTGACTCCTTGTAGGATCTGGGG
CTCCCTGATGCCAGAAGTATCTCTCTGGTTTTGTGAATTCTGGCTTCTAAAGAGATAGCA
TCTAAGTTCCCACTGCAACCTAGCTTCTCCCTTTATC


invisible?    
Gene introns: 0  

>6810 289 1950     17q24.3    chr17:68563753-68563465 BLAT!
CCATTTTTAGAAAATAACTGTGGTTACTTGGGCCAGTGTCAGGGCAACACTTTCCAAAAT
ACAATGACAAGGAAGATTTACAAGTCTCAAAGATATTTGAAGTTGATGGAGTCTGTAGCT
ACTTAAAGATCAGCAGCTTGTATTAGATTAAATAGAATTGGGTTATGATCTGGGCCCACT
GATTGTGAATATTCCGAACTCACTCATTTTCTTTCCTGATCTCAAATGCCATGATGCCTA
ATCTTTCCCATTGCAGTCCTTCTTCTCTAGATATAGGTTGCTCAGCCTT


invisible?    
Gene introns: 0  

>3594 254 1945     1q43    chr1:237131648-237131901 BLAT!
GGATGGAGGTGTCGGAGTCGAGGTGAGGGGAGGAAGGGCTACCATCTCATAAAATCACTT
AAGAGTTCTTGGGGGTTAAGACATACACATTTCAGAAAATTTGAAGGGGGACTGTATTAG
TGTCCTGTGGCTGCTATAGCAAATTAATACCAGCTTGGTGGCTTAAGACAGCAAATATGT
ATTCTCTCACTGTCCTTGTGGCCAGAAGTCATACATCAAGGTGTCAGCAGGACTCCACTC
TCTCCGAAGCCTCT


invisible?    
Gene introns: 0  

>1177 238 1942     7p14.3    chr7:31079498-31079735 BLAT!
CAACATGGTGAAACCTCATTTCTACTAAAAATACAAAAAATTAGCCAGGTGTGGTAGTGG
GTGCCTGTAGTCCCAGTTACTTGGAAGGCTGAGGCAGGAGAATGGCATGAACCCAGGAAG
CAGAGCTTGTAGTCAGCCGAGATTGCGCCACTGCACTCCAGCGTGGGTGACAGAGCAAGA
CTCCATCCCACCCCTCCAAAAAAAAATGTTTACAGGAATGGGGCTATCTCCTTGGATT


invisible?    
Gene introns: 0  

>25597 205 1941     3q26.2    chr3:168781400-168781196 BLAT!
TCATCATCATAACTAATTTTGCGGTGTAGGCAGGTATTCCCGAAAAAGAGACTTAGAAAT
GGAGACTTATATGCAGGAAGTTTATTGGGGATTGTTTTTGGAATTAACACCTGTGGAAGT
GAAGGAAATTGAACTATGATGCAGTCACAATAAAAACCTCAGCCTGTCTTCTGGAGAGCT
CGGGAGCTGGGAAGGCCTTTAGAGT


invisible?    
Gene introns: 0  

>27731 226 1941     4q22.1    chr4:92304931-92304706 BLAT!
TTCCTTTTTCTTCACTTAATATATTTTAATCTTGTCCCTCCCACCCTCAATAAGAAACAA
ATAAAGTGTAATGGGGATTAGCAAATTTATTCTATACGGAGCAACATAGTAAATATTTCA
GGCTTTGCAAGCCAAATGTTTTCTGTTGTAATTACTCAACTTTGAAACTATAGCACAAAA
GTGGCTATAGTTTGTCCTAAAAAATATGATTGAACTATTTATCCTA


invisible?    
Gene introns: FAM190A (91048683 - 92523370)  

>3914 407 1927     2q34    chr2:210044942-210044711 BLAT!
CCGCCCGGATATATGCTGCAAACTTCCAGTTGCCAGCAGAGAGGTTCTGGAGAGACCCTG
CAGAGCCTTCCAAGGTGGCTGGGTTGGAACTTTCTGCTAGAAGAGTCAGATATGGTTTTA
CCACCGATGGGTGCCACAGCATCTCAACCCCTTTGGGGGACTTCGACAGTCCTGGGATAG
GACCAACTCCATCCCATTGATCTTCTTGCGGAGTCCTCTTTTTCTTTTTCTTCTTCTTCC
CCCAGCAACTTGGCTCAGAGTCTTTGCTGGGAGACTCTTTTCCTAGTAAGTCATCCAATT
CGTTCAGTCCCAGTAACCGGGCCTGGGGCACCTCCAGCTCCAGCCGATAGGACAGGTTCC
TCAGGGTGCACACGCAGTTCTCCACCGTCTTGCTGTCGTAATCGGAT


invisible?    
Gene introns: 0  

>12133 214 1927     4q31.23    chr4:148530251-148530038 BLAT!
ATGTCCCAATTACAACGAGAAAATGGGATTCCAGAGAGGTAGAGGGTAGGTGGGAGTTGT
TAATAGACAAAGACAAATTTATGTGCAGTTAGCACAATGCATCATGGAGAAGGAATGGTC
ATAGGAGTGTTTTGACATGAAATCAAGGGGCAGCTTACTGAGGTCCACTGAGTAGACCTA
GACCTCTAGGACTACTGGGCAGAAACAAACTAGA


invisible?    
Gene introns: 0  

>12664 212 1927     2q37.1    chr2:235305285-235305496 BLAT!
TACCTCACACATGCTCATCATTTTAGCATAATTTGCTAAAATGGTTTTTAACTCCGAAAT
ATTTACCTCGAAACACACATACACACATAACTAATGGAACATGTTACGGTGCATTGTTAA
CACATGCTTTCCCCACGCTCAGAATGCCACCAACACGAGCCAGCACCGTGGGCTGCTTGC
ACACCCTGCCACAGAGCTCCGGCTCACTGCAC


invisible?    
Gene introns: 0  

Shown 331-360 from 3142 sequences on 12 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs