Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 391-420 from 3142 sequences on 14 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>15902 249 1799     4q33    chr4:171212937-171213185 BLAT!
TTGACTAGGGAGTAAAGTAAACTTTCTTAGAACATTGTTAAAACAAGCTACTGCATCCCT
TGGCTCAATTCTTCCCTACTACACACAAGAAACAGCTTCTAATTTTCACAACTGCACAAT
CAAAGTTTCTTTTTCCGATGTTGTTTATGACCTAGTTTTAACATTTTGAAGTATTCTTTC
ACTCCTTTTCTAGTGTGAAAAATGGTGTCCATCCATCATTAATTTATGCTGCTATTATGC
AGCCAAAAT


invisible?    
Gene introns: 0  

>29981 227 1795     20p11.23    chr20:20834948-20835138 BLAT!
TGGATCACGCCCTTTTGTTTAGCTCTCGCCGCTGCGGCTATGCCTGCTGTCTGTGCTGCG
ATGCCTGTGCCCTTCTTGGCATTCCGAAATCCCTCTGTGCCACAGGAAGCAAAGGCAAGG
GGCTCATTACTAGCAGAGACTACCTGGATCTGTGTGTTGTTGTGGGATGCTTTAATGTGC
GCAATTGGGATCTCCTCAAATTTCTTTCCTGCCCACCTCAGAGAGCT


invisible?    
Gene introns: 0  

>830 210 1794     2q35    chr2:220729109-220729319 BLAT!
ATAATTAGGCAGCCTTTATGAGGCAAGCAGGGAGAAGTCATTAGGGCTGCTGTTTAACAA
AGGGAAACTTCCTGCTCCCACCCCCCGTTAAAGAGCTGCTTTTCAACTGTGTTGGGCTTC
TTTGATCCCTGAAGTCTCCTGATGTTTTGCTCACATCCTGTCATGATATTTAATGATGCT
TCATGTGTGCACCAGGAGCACGGCCCAACT


invisible?    
Gene introns: 0  

>3107 354 1793     12q21.31    chr12:83798332-83798685 BLAT!
TTAATTTTTCCAAGTCAATTTTATTACAAAAGAGAAAAAGTATTCATCTATTAATACAGA
GACTGTTTCCATAGTGATATCTCTAAAAGTGTATATACAAAAGAATAAATTGACTCATTG
ACCTGGTATTAGATTTGGCTGAGTAGCATGATCATAGGAATGCAGTGGCCAACGGAACTT
TCAGATCTCTAAAGAACCCATGCGAATCTAATGCCTTGCTTTGGCTCTTAGTTCTTTTCC
TCTTACCTTTGTCCCTTCTGCTTCTATATTAGTCCGTCCTGGCTGCTATAACAAAATGCC
ACAAATGGGCTAGCTTAAAAAACAAAATTTATTTTCTCATAGTTCTAGAGGCTA


invisible?    
Gene introns: 0  

>17034 235 1782     5q14.3    chr5:83225163-83225397 BLAT!
ATATTACTCAGCTCCTTCATTTTATTGATAGGAAAATAAGCTCAGAGAGGGTTAAGTTTT
GTTTATGAATTTGGCTCAATTATATATTAATTATTAGCTCATGTGTTCATTCTCCACAGA
CCTTCATATCTTTCATTGCAGTCTTCTCCCAATTCTTTAATTTCAAGTTAAGACAGAAAA
GCTGGAGTCTAGGTGTCACACGGAAGTATTTTGGGGACAACCCCTGCTGAATGAG


invisible?    
Gene introns: 0  

>11434 207 1778     12q23.3    chr12:106564993-106565199 BLAT!
ACAAAGAATTTCGTTCAAACCAAGAGCTAGAGAGATTGCGTAATCATCTTTTAGAATCAG
AAGATTCTTATACCCGTGAAGCTTTGGCTGCAGAAGATAGAGAGGCTAAACTAAGAAAGA
AAGTCACAGTATTGGAGGAAAAGCTAGTTTCATCCTCTAATGCAATGGAAAATGCAAGCC
ATCAAGCCAGTGTGCAGGTAGAGTCAT


invisible?    
Gene introns: 0  

>27402 220 1776     15q22.31    chr15:65334420-65334639 BLAT!
TCTATGAGAAAATAAACTCTTATGGTTTAAACCACTGACATTGGGTCTTTGTTACCCAGA
GCCAAACACAATTCTCAACTGATATGGAAGGCCTCCCTAAGAAGATGACATTTAAGCTGA
GGCTTGAAGGGTTAGCAGGTGGCAGATACCAGAATAGCAGAGGAAAACCAAAAGCCCTTT
CCACTCCACTACACTGCTGACTGTCTATCATCCTCTAGGT


invisible?    
Gene introns: 0  

>33212 243 1775     6q14.1    chr6:82974045-82974201 BLAT!
TCCTGGAGGACCTACATAATTCCCAGGAGATGCTGAGGAGTATGGTATTGAATTGGCATT
TGTTGGGTTTGGCCAAGGTCTACCACCACCTGGACCCATGTTCATTCCAGGCATTCCAGG
GCCACCTAAAGCATTCAGTGGGGGTCTCATTGCACCTCCATAGTTCTGTGGTCCTAAGGG
CACCATTCCTCTTGGAGGAGTCATTCTCTGCATTGGCCCACCCATATTTGGATGTCCTTG
TTG


invisible?    
Gene introns: 0  

>23691 209 1762     15q21.1    chr15:47098121-47098329 BLAT!
ATATGAACGCTTTTCCAAAGAAACATAGAAGCAGCCAACAAACATATGAAAAAATGCTTA
ACGTCATTAATCATCAGAGAAATGCAAATGACAACCACAATGAGATATCATCTTACATCA
GTTGGAATGCCTATTATTAAAAAGTCAAAAAATAATGGCTATTATTAAAAGTCAATAATA
TGTTGGTAAGACTGTGGAGAAAAGGGAAT


invisible?    
Gene introns: 0  

>23345 215 1761     21q21.3    chr21:28145432-28145646 BLAT!
GTAGCCTTAGATGCTTAGAAAAATAAATGAGTAAACCAAACATTCAGTTACAAAATTACT
CTGAGTTTCTCAACAGGTGTGTTATTGGTCTTTGGGGAAAAACAATTCTTTGTTGAGCAG
GAATGTCCTACGCGTTACAGGATAAATACCACCCTAGGCTTCACCCGCCTAATGCATATT
GCACTCCAGGGTTATTGTGAAAAGATAAAATACCT


invisible?    
Gene introns: 0  

>27647 296 1756     14q21.1    chr14:39685331-39685626 BLAT!
GACACATTCGCCTAGAGAACAACGAGAATAAACCAGTGACCAACTCTAGGGACACTCAGG
AAGTGCCTCTGGAAAAGGCTAAGCAGGTGTTGAAAATTATAGCCAGCTACAAGCACACCA
CTTCCATTTTTGATGACTTCTCACACTATGAGAAACGCCAAGAGGAAGAAGAAAGTGTTA
AAAAGGAACGTCAAGGTCGTGGGAAATAAAAGGCAGTTCTACACAGACTGCAGCAACGGT
TGCATCTGCATATCCTAAGAGGAAAAAATGACCTTCAAGAGAATTAGGACTTTTTT


invisible?    
Gene introns: 0  

>13687 155 1754     4q26    chr4:117520338-117520480 BLAT!
ATGAATGAGTTCCGGGCCTCCTTCAACCACTTTGACCGGGATCACTCCGGCACACTGGGT
CCCGAGGAGTTCAAAGCCTGCCTCATCAGCTTGGGTTATGATATTGGCAACGACCCCCAG
GGAGAAGCAGAATTTGCCCGCATCATGAGCATTGT


invisible?    
Gene introns: 0  

>20311 359 1751     11p14.1    chr11:28617231-28616873 BLAT!
CTGAAATGACAGTAAAGTGATCTTTTTAAAAGGGCTAAGCTCACAAAAATAAAAAAAGGA
AGAGGAGAATACAGCAACATTTTGGAAGCTGGAAGGCAGATGGATGAGTGATAACTGATT
CAACAGATCCTAAAATACTGAAACCTAAAGAGGAAAACAGATAAGTAACTTAATTTGCAC
TCCTCAGCCCCAGAATATAATTGTAGGAATGAAGTCTTTGAGAAGGCAAGAAAGAGAAAT
CTAGAGCAAAAACAGGATGTGAAGGTCTTCCCACTTGAGGAGAAAACATAGAGGAGGACA
TTACCCCTCCCAAAAAAAGAGAGAGAAAGCGAGAATAAAAAACAAATGTTCCAGAACTG


invisible?    
Gene introns: 0  

>31007 233 1751     13q13.1    chr13:32768099-32768331 BLAT!
ACATTTCAGTTTTCAGTTACGACATTATACTCTTGAAGAATATATGACATAAAAACCAAA
ATGAAAGCTCGGTCTTCCCTTTCATTTTACTCAGTTTATATTGACTAAGCTTTATCTGTA
TCTTTCTCTAGAACATTCTTTCATCAAATGGGAATAATATTGATTTGCTCCATGTATTCA
GGTTCATCAACTTGGCTGCGAAGTTGTTGTCTTGCTACTGGAACTTAATCCTG


invisible?    
Gene introns: FRY (32605436 - 32870776)  

>33038 221 1750     2q31.1    chr2:176967148-176966928 BLAT!
ACTGTTTTTGACAAAATCAAAACAAAACATGCATGATAACTATTAGATAGCCTAGAAAAT
GAAATTAGTTTAAATATCAACTGAAGTCAGTTGGGCTAAGGCTCAGGGCTCTCTGTGAGG
GGCCCACTCCAGATTTAGGGCCAGGTCCTGCACTGAAAAGAAATCACTGGACTTTGGGAA
GGAATCCTGAATCCTTGAGTTGTTGTGCATCATGCTAGGAA


invisible?    
Gene introns: 0  

>22790 218 1748     6q22.1    chr6:116937180-116937397 BLAT!
CGAGATTACCAAGGTCAGTCTCTTCCTCCCTCTCTACCCCTCACTCTCCTCTCTCCCTCC
CTCCCTTCCTTCCTCCGTTCTTTCCTTCCTTCCTTCTCTCTCTCTCTCACACACACACAC
CCTCCACACACACGCTTCATGAATACACTGTCCCTCCACTAACGCACGACTCGCTCCTCA
CAGCACAACTTGGATCAGTCTCAGACCCCTAAAGGTCT


invisible?    
Gene introns: 0  

>3907 208 1746     3q25.2    chr3:154070758-154070965 BLAT!
CAGGAATGTCCAAACCACGGGCAGCCACATTGGTTGCCACCAAAACTTTAAAACTACCTT
CTCTGAAGCCTTTTAGTGTAATTTCTCTTTGTGACTGTGCAATGTCCCCATGTAAACACT
GGGCATTCTGTTTTATGTGTGGATTCATGGCCATTTCAGTTACATTCTTCTTGGTCTCAC
AGAAAATAATAGCCCTCCCTTCAGACCC


invisible?    
Gene introns: GPR149 (154055460 - 154147504)  

>29190 211 1746     17q21.1    chr17:38135577-38135787 BLAT!
ATTGTTAAGGATGAACATAACTCATCTGTTTTCTTCCTTACCATTCTCGCCCACCTTCAG
TTGCAGATATGGTGTTATGAAGAGGTTCTAATGAGTTTATTCCAATGATGATTCAAAAGT
CCTGTTATCCACCCCCCAGCCCTGGAGGGTGAGAGGACAGTTGAGGAGGAACTGGTCAAG
GCATGTTCCCTAAAACTAGAGCACATATCTT


invisible?    
Gene introns: 0  

>16318 173 1742     21q22.11    chr21:32434106-32434269 BLAT!
GATTGAAGATTTCCTCCACAACCAGCTGAAAAAATTCTTTGGAAACACCTCCCTCATCAA
CTCCTTGTTCTCCTTCAAATTCCACATACAACTGCTTCTTCAAGTCTGCAGGATTTTCCA
TAGCGATCATCTCTAGCCGGACAAGTGCATCATCTATGATATGGTCACGTCTA


invisible?    
Gene introns: 0  

>22683 195 1742     3p22.1    chr3:42396462-42396268 BLAT!
ATTTGTATGCATATATATTTTAGAGTGAGAAGAAAGTCAGAATGCAAAGGAGTGAGAATG
ACATTTTAGGAATGGACTTAAGACCTCTAATTTGTATAAAGGATGAAAAGGAGGAGGTGG
GAGAGAAGGAGGAGGGAGAAAAGGAGGAGGAGGAGTGTGAGGAACAAGAGGAGGAAGGTA
AGGAGGAAGAGGAGG


invisible?    
Gene introns: 0  

>7011 269 1740     3q26.31    chr3:175527471-175527739 BLAT!
AGAACCTATCTCAAAAAAAGGAAAAGAAAGTCACATGCTGTTGATAGTAGTTTTATATGT
ATTTGGAATGTTAATATGGGACACATGCATTTAATACTTTAATCATGTATTCAATGTAGC
AGCATTTAGATATGTAAGATTTTAGAAGTAAAATCTCAGTGGTATAACATTTAAAACACA
GCCTTAAAATGAAGAATAGGGATGAGCAGGAGAAAATTTATAAATTAACCCAGGGTAAAA
TTTGGAGGAAAATTTTTCCAAATAAATTT


invisible?    
Gene introns: 0  

>21680 197 1739     1q41    chr1:219463093-219462902 BLAT!
GCGAGCAATTGTGGGCATTAACTAAAACAATACGCTTGAAAGTGTTTGACAATACCAGCA
GCTCATGAAAAAGAAAAACATCTAAAACAGAATGTGGGTGAAAAGACTGAGAGTAATTTT
CTACTTGAAGCAGAGTCTTCACTGAAAACCATACTTTTTTCTGCATGCCCACACTCTACA
GCCTATTGGCTTTTTTT


invisible?    
Gene introns: 0  

>10193 227 1731     7p14.3    chr7:31079475-31079701 BLAT!
AGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCTCATTTCTACTAAAAATACAAAA
AATTAGCCAGGTGTGGTAGTGGGTGCCTGTAGTCCCAGTTACTTGGAAGGCTGAGGCAGG
AGAATGGCATGAACCCAGGAAGCAGAGCTTGTAGTCAGCCGAGATTGCGCCACTGCACTC
CAGCGTGGGTGACAGAGCAAGACTCCATCCCACCCCTCCAAAAAAAA


invisible?    
Gene introns: 0  

>33020 233 1730     10q25.1    chr10:108112845-108112613 BLAT!
AGGTATTTTTTGATCATCCCTCTTTTAGGTAATGGCCTAATTTTCTGGTTTTTTTAGTTT
GTTTTAGCTTAAATTCCCGAGAATCTACTCGACCCAGCCCATGATTTATTTTTCAGGATT
TAGCATTTCAAGTGTTGCTGACCAGCCTGAAAATTTACTTTTGGGGGTATCATTGTCCCC
CTAAATCCTATTATTCCTTGGGGATTGGGCAAGGGCATAGGATCTGCATAGAG


invisible?    
Gene introns: 0  

>33122 279 1728     6p12.1    chr6:55185260-55184982 BLAT!
CATCAGGGAGCTAACAAGACAGACTAATAGTAGCTCTCAGGTAGACTAAGCAGAACTTGG
CTTGTCCCCAGCCTATTTTTCCTAAAAGGAGTTTGTTCACATACCAAGTGTCACAACTTC
TATAGCTCTATTCATTTCTTCTATTATTTTATAGCCTACCTATTCTTCTTGAAAAGAGTT
TGTTCACAATTAAGTGTCACAACTTCTACAGCTCCCACCCAAAGGACTGAATTCTTAACA
GCCTAAGCTTGGGAGTGGTGGAGCTTTGCATTCCTAACT


invisible?    
Gene introns: 0  

>15506 192 1722     Xq24    chrX:120337775-120337584 BLAT!
ATGAAGCTGTTGCTTATGGTGCAGCTGTCCAGGCAGCCATCTTGTCTGGAGACAAGTCTG
AGAATGTTCAAGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGTATTGAAACTG
CTGGTGGAGTCATGACTGTCCTCATCAAGCGTAATACCACCATTCCTACCAAGCAGACAC
AGACCTTCACTA


invisible?    
Gene introns: 0  

>30675 254 1721     11q13.1    chr11:64903740-64903993 BLAT!
CCTGCTTTTAAAACAGTTCAGTGTCCCTAGACACTGTCTGCACCCCAGCTCCGGAAACGG
GCATCATGCTCACTATCTGCCCCCACATCCAAACTGGTAATTAAGTCATTTATTCAGTTA
GTCTACAAATATGGATCAAGTGTCTCCTGTTCTAGGGACTTAGGATGTCAGTGAACAAAA
TAAAGATCTCTACCTTTGTGGAGCTTATCCTAGTAGATGTGACAGCAAACCACAGACATA
AGTGAAAAATCTAA


invisible?    
Gene introns: 0  

>32663 239 1719     12p13.1    chr12:14196136-14195898 BLAT!
GACTACCGCTCCTGACTGCATCTGGCCTGCTGTATTCTGTCGTTGCTCACCTGCTCAATG
CAAGGCAAGGAATATTTAAGAACGTCAGATTCATTGACATCAGCTTTTGTATTCCTTGTT
GCTCTCTTGAATGTGAATACACTAAATTTGATTGAATAAGCCTGGATTTTTACATTATAA
TTCTGCGTCTGCCTAAAGTTTACTGTGTAATTCATCTTAAAGCTCTGAATTTTTCATTG


invisible?    
Gene introns: 0  

>6317 174 1711     2q31.1    chr2:172348274-172348444 BLAT!
ATCCTGGTTTCCAACTATAACCCAAAGGAATTTGAAAGTTGTATTCAGTATTATTTGGAA
AACAATTGGCTTCAACATGAGAAAGCTCCTACAGAAGAAGGGAAAAAAGAGCTGCTGTTC
CTAAGTAACGCGAACCCCTCGCTGCTGGAGCGGCACTGTGCCTACCTCTAAGCC


invisible?    
Gene introns: 0  

>14212 231 1700     1p13.2    chr1:114610648-114610418 BLAT!
TTTATACATGATCAGGTTTAAGCAGGTCCTGAAGGCACAAGTAGGTTACATGAGGAAGTG
GCTCAAATGCCCATGGTCTCCACTCCTGCCACCCTGCCTTCTCTTCCCTAGCCTGCACCA
ATGGCCTCATGGGGAGTTCCCTATGATCAGTGGACAGAGGAAGAGAACATTAGGGCCTGG
TTCACAGATGGCTCTGCGTGATATGCAGGCACCACCCGAAAGTAGACAGCT


invisible?    
Gene introns: 0  

Shown 391-420 from 3142 sequences on 14 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs