Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 451-480 from 3142 sequences on 16 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>8677 235 1611     6q16.1    chr6:93324463-93324697 BLAT!
GGGTTTGTCATAGATGCCTGTTATTACCTTAAGATATGTCCCTTCTATGCCAATTTAGCT
AAGGGTTTTAATCATAAACGGATGCTGAATTTTGTCAAATGCTTTTTCTGCATCTATTGA
GATGATCATGTGATTTCTGTTTTTAATTCTGTTTATGTGTTGTATCACATTTCTTGACTT
GCATATGTTAAGCCATTCCTGGATTCCTGGTATGAAACCCACTTGATCATGGTGG


invisible?    
Gene introns: 0  

>6986 221 1610     9q32    chr9:116479567-116479787 BLAT!
TTGTAAAGTGGGCATGATTATGCCCATTTTACAGATGAAGAAACTGAAGCTAAGACCAAT
GGAATAACTTGCAAAAGCTCACAGGGCTGGCAGAGCCAGGATTCAAATCCAAGCTTGATG
GGCTCCAAATTAGTCTAAGCTGTTCAATAACTCAGCTCCAAGATTTGGACCTTTGTTTTC
GGTTTTCCTGTAACAAAGATCCCCAAGTGATGGATTTCTAT


invisible?    
Gene introns: 0  

>4083 245 1608     1q43    chr1:237248784-237249028 BLAT!
TGGAGGAGGAGAAGGGAAGCAATGAGAAAGATCAGGAGGCTGAAGCCACAAGGGTATACA
ACAGCTGTGATTTTAGAAGAGTGTAATTGGGTGCACGTGTGTGTTTAATCTATTTGATTA
GATTGCTTTCCTAATATCAAGAACCAAGAGCATTTGAGGTGAACTGCCCCATTACTTGAT
CTCAGTTGGAGGGGCCTGGAATCCTGGGAACTTGAGGGGGAGAAGAGAGCTATTCAGACA
GGGAT


invisible?    
Gene introns: RYR2 (237205701 - 237997288)  

>19487 248 1599     2q34    chr2:210137647-210137894 BLAT!
TCCGGCCAAGGCAGATGGAGTTTTGTCTTTACACAGAAAAGACTTTAATTGCTGGGTAAA
ACATACTTTTGGCAATACTCCCTTTGTGAAACCTAAGAAGCCAAATGGGCGTGGCCACCC
ATACCTCCCCACAAAAAATAAAGACAGAATCAATTCAATTATAGACCAACATTCCCATCA
CCATAAAATCAGGCCTATTATTTGTCCTATATGATTGTGAAAGCCTTATCTTTTCCAAAG
CCCCAAGG


invisible?    
Gene introns: 0  

>21581 220 1589     Xq27.3    chrX:143333009-143333087 BLAT!
CAGCTTCACCATGCTTGTTTCTCCTTCATCTTCTGCCATAATTGTAAGCTTTCTGAGGCC
TCCCAAATTGAATCCATTAACTATGTGGAGTTTTTCTGTATACCAACTATATCGCAATAA
ACCAAAAGAGAGGTAGACAAAACAATACCTCCAGCATGAAAACAGAATCTACTGTTGGCC
AGGACAGTTAGGTAAGGGTTCCTGTTAAATCCTGCCTTTT


invisible?    
Gene introns: 0  

>4478 220 1588     Xq24    chrX:120141269-120141488 BLAT!
ATATAATAATAAAAGCTAATTGAACATAGCTGCCACTTGCTTTTTGCCTGATGTCTAATT
CCTGCTATTTACTGTATGCAGTCTGTTTTATCCTTGCCTCTCCCAGCTGATTGTCACCTG
AAAAACAGATCTCTCACTGTTTGACTTTTATATCTGAGAATCAGAGAATTGGCAAGTTGA
TATTCTGAAATCCCCATTAGAAAAAGCAGAATGGGGAAGG


invisible?    
Gene introns: 0  

>15775 232 1585     6q21    chr6:110248669-110248438 BLAT!
TGAGCCACCACACCTGGAAGTTTATTTTTATTATTATTTTTTAATGTAAAGGGTTATCCC
TTACAGACAGATTTGCATTTAGCCAATGTCAACATCTTTAGTGGCTCATGACAGATTTGC
AAGCATTCAGTAAAGGTTGATGACTAAGTTATTCCTTACATCACATGAGCCCAGGTCACC
TCTAGTTTCCATTGGTCCTGAAAGCATTACACTATAAATCAAGGAGAGACTT


invisible?    
Gene introns: 0  

>21304 189 1583     6q14.1    chr6:77664525-77664713 BLAT!
CTGGAGGTTGTGCCAGGCACGCACAACTGTGTCTCCAGTCATTGTGTTCTAAGTGTTGGC
AACAGCATATTTGGCAAAAATATGCTAAATTTCATGATAAACTCCTTTTGAAAACCTTCC
CTATCCATCATCTGTTCACTGCTGCTAGCATGCTGTTCAAAAATTGTTTTTATATTTCTG
TTTGTTGCT


invisible?    
Gene introns: 0  

>18581 239 1579     16p12.2    chr16:21356456-21356694 BLAT!
GGGACATGACCCATCACTGGAGGTGCTCAGGTGGAGTCAGGGTCTTTGGCTGGAGCCAAG
CTCTCCACATGCAGCATGCAGGTGGGCATGTTGAATCTCCTTTGAATCTCATGAATTTGA
GATTCTGATTTAGTGTAGCTAGGCAATTTCTAGCATATTGCAAGTATCAACATTCTGTTA
TGTGGCTGGGCACAGTGGCTTACACCTATAATCCCAGCATTTTGGGAGGCCAAGGCAGG


invisible?    
Gene introns: 0  

>22247 292 1579     4p11    chr4:49095655-49095545 BLAT!
AATGGACTGAAGTGTAGTATAATGTAATGGAATGGAATGGAGTGGAATGGAGTGGAGTGG
AATGGAATGGAATGGAGTGGAATGGAGAGGAGTGGAATGGAGTGGAGTGGAAAGGAATTG
GGTGGAATGGAATGGATTGGGGTGCAGTATAATGGAGCATACTGGAGTGGAATGGAGTGG
AGTGGAGTTTAATGGAATGGAGTTGAGTGGAGTGGGGTATAGTGGAGGGGAGTAGAATTT
AGTGGAATGGAATGGAAAGATGTGCAGTGGAGTTGAATGGAGTAGAATGGAA


invisible?    
Gene introns: 0  

>9847 229 1577     11q13.4    chr11:71261796-71262024 BLAT!
CCTATGTTCATGTATTGGAAGACCTAATATTGTGAAGATTGAAACACTCCAAAAAAAAAT
TGTTCTACCAATTTAATGCAATTCCGATCAACATCTCAGATTTCTTTTTTCAAAAATTGA
CAAGTTGATCCTAAAATTTATGTGGACATTCAAGGGACCCTAAATAGCTAAAACAATCTT
GAAAAAGAAAAGCAAAGTTTGAGGACTCAGGTTTTCCAATTTCTAAATG


invisible?    
Gene introns: 0  

>25801 310 1574     Xq21.32    chrX:93294835-93294561 BLAT!
CATAGGGTTTATTGAGAGGTTCTGGGAAGCAGGAGGTACATATCACGTGCATTTATTTAT
ACATATATTTATATGAAATTGAAAAAGAGGTAAAACTAATCTAAAAGTGGTTGAAATTAG
AATAATGGTTGACTTTGGGAGGGAGGGATTAGCTGAGAAGGGGTTTAGAGAAACTTTCTG
TGATTAATAGAGATGTTCTTCATCTCAATCTGGGTAATGGTTTCATGGGTGTGTTAAAAG
CAAAATTTTATACAAGTTACATTTTACAGAATTTAATTGAGCAAATAACAATTCACAAAT
TGGGTAGCCT


invisible?    
Gene introns: 0  

>753 236 1571     2q33.2    chr2:204499611-204499410 BLAT!
GAGCGGCCGCCCGGGCAGGTACGCGGGGGGGCACAGTTACCTAAGTATCAACGTAATCTT
CCTCGGCCAGGACAGGCCCCCATCGGTAATCCACCAGTTGGACCAATTGGAGGTATGATG
CCACCACAGCCAGGCATCCCACAGCAACAAGGAATGAGACCCCCAATGCCACCTCATGGT
CAGTATGGTGGTCATCATCAAGGCATGCCAGGATACCTTCCTGGTGCTATGCCCCC


invisible?    
Gene introns: 0  

>9252 327 1564     2q36.2    chr2:225533362-225533688 BLAT!
TGGACTCAGGTTACTCCAAACATTGTGTTTTAAACCCCTGCATCGTTTTCCAAAACTGAT
CCAAGGACCTCTTGCATAAAAATCACCCGGGATGCTTATTAAAAATGCAGATTCAGGCCG
GGTGCGGTGGCTCTTGCATGTAATCCCAGCGCTTTGGGAGGCCGAGATGGGTGGATCACC
TGAAGTCAGTAGTTCGAGACCAGCCTGGTCAACATGGTGAAACCCTGTCTCTACTAAGAA
TACAAAAATTAGCCCGGCGTGGTGGCACATGCCTGTAATCCCAGCTGCAAGGGAAACTGA
AGCAGAAGAATTGCTTGAACCCACGAG


invisible?    
Gene introns: 0  

>16052 300 1558     2q14.3    chr2:124519790-124519968 BLAT!
AGCGTGGTCGCGGCCGAGGTACGCGGGGGGAGGAGGTATGCCTGGACTGGGCCAGGGGCC
ACCTACAGATGCTCCTGCAGTGGACACAGCAGAACAAGTCTATATCTCTTCCCTGGCACT
GTTAAAAATGTTAAAACATGGCCGTGCTGGAGTTCCAATGGAAGTTATGGGTTTGATGCT
TGGAGAATTTGTTGATGATTATACCGTCAGAGTGATTGATGTGTTTGCTATGCCACAGTC
AGGAACAGGTGTCAGTGTGGAGGCAGTTGATCCAGTGTTCCAAGCTAAAATGTTGGATAT


invisible?    
Gene introns: 0  

>12 196 1557     21q21.3    chr21:29230376-29230571 BLAT!
ATATTAAAAAATTGTGAGAAGGAGTTTACACAGGTCAGCCTATAAAACTACTGCATAATT
TCTATCTGTAAATTAAAATAGAAAAGAAATAACATTGAATTAAATATGATAATAGTAAAT
TTCATTTCTAAGTGTGCCAAACTAGCTGGCCTTTCCTATTCTTGAATAAAATTATTCTGG
TTGCCATAATGCATCC


invisible?    
Gene introns: 0  

>10640 269 1557     8q11.23    chr8:55435204-55435472 BLAT!
AACTAATGCAAACCAGTGCTACCCAGAAGCACCAACACGTGTGTTCTCCATTCCACCAAT
CACAGACCAGTATCTACTCCAAACATCCAGTAACGAAAACTATGGCATCTTCCCAGGAAC
AGCAAGGCAGGCTTCTTACTCACGATGAACCAGCACGAATAAACCCAGCAAAAAGAGAAC
TGCATACTTAAATTTAGGATAGTCATTCATGAGGATCGTCACAATTCCAATATAAGGAAC
AAATCCCCTGGCTCTCCCCACAACATCTT


invisible?    
Gene introns: 0  

>21432 221 1557     Xp22.33    chrX:1576723-1576503 BLAT!
ATAGATGATAGATACATACATACATAGATGGATAGATAGATGATAGATACATACATACAT
ACATACATAGATGGATAGATAGATACATACATACATACATAGATGGATAGAGAGATACAT
AGATATTATGGCTAAATAGATGGAAGAGTGATAGATACATAGACAAGATAGATGGATACA
TGACAGATGAATAGCTGGATAAATGATGGATAACATGGATA


invisible?    
Gene introns: 0  

>21827 284 1555     5q21.3    chr5:109598541-109598257 BLAT!
AAGAAAAGTGAGTCATTAAGTATGACTATAAATCTTATCTCTAATGTCTTCTTTTCCACT
CTAAAAATTGGGACTTATTCAAGGCATAAAGGGGTGTGGAACCAAGGACTTAAAGCCATT
CTGTAAAATTTATCAACTCTCAATTATTCTCAGCAAATTAAAGAAAAAAAAAAAAGGAAA
AACAGCCTGCTTTCACCTTGCCCTTCAGCAGATTTCTGTGTGCCCTGCCTCCCAGCTGGC
ACATTAGCTCAGGACACAGCTAACCTTGGACTTTGGTTTGCTGC


invisible?    
Gene introns: 0  

>13945 245 1554     13q32.2    chr13:98788171-98788415 BLAT!
TCATTTCTTTCTCTGAGATGAGAATCAAAGGGCAAGATCGTAGGCCAGACTGAAAATGAT
TTCAGTCTATGACCTTCTTTTGCTTCCCTTCTGAAGTTCTCCTTTTGAAAGTGAAGTGAA
AAATAAATGACCTGAAGTCTTCACTTTTTATCCTATCCTATTTTCTATCCTAAAAAAGTG
CATTTTGAATGCTTTCTCCAGTTGTCCTAGATTTTTGAATATGGAGGCACAACACAGGAT
CATGG


invisible?    
Gene introns: 0  

>18730 126 1554     17q24.3    chr17:69617378-69617260 BLAT!
TAGGTGCCCTGGTCCTTGTTCTTGGCCACTGTCTGCAGCATGGGCAGAAAGTGCTCAAAG
TCCAGCACCTTCACATTCATCTCATCACTCTTGGGGTTCCCCAGGACCTTGAGCACCTCG
GCGTTG


invisible?    
Gene introns: 0  

>7929 212 1550     2q36.1    chr2:222670989-222670778 BLAT!
TAGTATTTGGGTTTTGATTCTAAGTCTGACTGGCTTTGTATTGTTATCCATTATAATAGT
GATGATGATAATAAGAAGAATATCAATTCTAGTAACAACTAAGACATATATGATCCTCAC
TACATGCCTGGCACCGTTCCAAGCCCTGTATGTGTATTAATTCATTACCACGAAAGACAG
TTCCTATTATTATCCTCATTCTGCAGATGAGG


invisible?    
Gene introns: 0  

>10935 224 1548     12q21.2    chr12:78017584-78017361 BLAT!
AATTCTCCCCTGGGAAATGCTCTCGATTTAAAGGTTGAAATGTTCGTCTTTATCATACTG
ATAAGGCTTATCTCTCTCATTGTTTTCAAGAGAAAACTCAAGGAAAATCCTGGCATTTTA
GTATTCTTCGAGACAACAAGTGTATAAAGATACCTTTCCCTCAGAGAACAGGCTAGACCC
AAATAATGCTGAGCAGCGGTAAAATAGATTTCTGTGAATATTTT


invisible?    
Gene introns: 0  

>29581 289 1545     2q31.3    chr2:181637811-181638099 BLAT!
AACATTTATTTTCTGTAGCTCTCTTTCTCTGATCTTTTTATTGGACATTTGTTAATTTTT
ATTAATCTTAGAAATGATTCTCACTCAAAATAAAAATAATTTTAAGAAATCTTAAGAATG
AGTGAAGCACATTCCATGCATTTTAATCTAAAGAATAATAGAGAATTGTTTATGTATTTA
TAACAAGTAAATGTGAAAAACTGAAATTCCCTGCTTAATAAATTAAGAATGTCTAACCTG
ATGTCTTGTATAGCTGTCCAATCACATACTGCTTACACTTTAAAGATCA


invisible?    
Gene introns: 0  

>29460 224 1541     19q13.31    chr19:44970872-44970649 BLAT!
TACAGATATGTTCTCTCAATAGATTCTGCATCTCTAAATAAAGCAGAGCTTTCAAACGAA
AGTTGTAAGCAGTTATAAAGGACTTCAAAAAGAATATGTTACTAACAATTGTCCAATTAC
CAAAATCTGACAATGATTAAAAACAAAATCTAGGGGAGTCAGCACAGTTGTCCTAATAGC
ACTGCTCTGTCAGTAACACTACTGTATCCTTCTTCTGTGGGAGG


invisible?    
Gene introns: 0  

>10044 221 1538     18q11.1    chr18:18899836-18900056 BLAT!
GAGCTGGTTTGGCCTAAAGAAAAAGCAAGGTGGTTGGAGCTAAATAAGGAATGCCCACAG
AAATATCATTCGTATAAAGCAGTCTGTGGGTAAGGCATGGTAAAGGAAAGAGACTCAAAT
TTTTGAATAGGACTTTAACTTCCACTTCTCTTCTGATCAAGAAGTTAAAGCTAACACACA
CACAACATTGTGTCAAAGAGAGAATTCCTGCTAGCTCAAAA


invisible?    
Gene introns: GREB1L (18822202 - 19102791)  

>16510 207 1536     21q21.3    chr21:29230353-29230559 BLAT!
ATGATAAAAGAATCCTCAGAACTATATTAAAAAATTGTGAGAAGGAGTTTACACAGGTCA
GCCTATAAAACTACTGCATAATTTCTATCTGTAAATTAAAATAGAAAAGAAATAACATTG
AATTAAATATGATAATAGTAAATTTCATTTCTAAGTGTGCCAAACTAGCTGGCCTTTCCT
ATTCTTGAATAAAATTATTCTGGTTGC


invisible?    
Gene introns: 0  

>20279 231 1531     6q25.3    chr6:158111412-158111182 BLAT!
CTGCACCAGGTAGTGCTCGAGGCACTGGGAAACAGATCCCCTGATTCAAGACAAAGTCCT
TGTTTTCAAATGGAAGTTACATATTCTATTAGGGAAGACAGAATATAAACAACTTCAACA
TTGCATATAATATCAGCAAGCAAAAACTGCCATGAAGAGTCAAAAAGCAAAGCAAGGGGC
TGGACAGTGCTCAGGAGAGACAGTAACTTGGGCAGAGGGTGTGAGCACGTG


invisible?    
Gene introns: 0  

>17052 227 1526     17p13.2    chr17:4475504-4475729 BLAT!
GTGAAGCAGATCGAGAGCAAGACTGCTTTTCAGGAAGCCTTGGACGCTGCAGGTGATAAA
CTTGTAGTAGTTGACTTCTCAGCCACGTGGTGTGGGCCTTGCAAAATGATCAAGCCTTTC
TTTCATTCCCTCTCTGAAAAGTATTCCAACGTGATATTCCTTGAAGTAGATGTGGATGAC
TGTCAGGATGTTGCTTCAGAGTGTGAAGTCAAATGCATGCCAACATT


invisible?    
Gene introns: 0  

>11536 190 1523     12q21.31    chr12:80945048-80945237 BLAT!
CAAGCCTCATAGTTTTATACAATTCCTTACTCCATCTCTTCTACATACAATCAGGTCTTA
TCAATTCAATTTCCATCAGGGCTCTGCAATTTGCCCCTTCTCCACCTTGGCCACCACCAT
TGTATATTAGAGGGACCTTGTTGCTTCCTGTAATAACATCTTAACTAGCCTTATCACCCA
CACTACTTTA


invisible?    
Gene introns: PTPRQ (80838125 - 81073968)  

Shown 451-480 from 3142 sequences on 16 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs