Postparser v2.3 // project Bladder

Databases: ABC2_contigs

Shown 481-510 from 3142 sequences on 17 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

>22764 234 1515     12q21.2    chr12:78118871-78119104 BLAT!
TTCAAGATAATTTAAGCATCTAGGCGATACTGGTATTAAACTTTTTTCCATTGAGGATTT
CCCTTTTCTTTTCCATTTGGGAAATACAACATGCTTCCCAGATTCCAAATTTCACTGCTT
ATTTTTATGACTACTATAAAAGGATAAGAAGAGGATAAAATAGTAAAAGGGTAATAATAT
TATCCTGGGAGCTATTTCTGTATCTCAGTGCTAAAAGCCATCAAACTATATAGA


invisible?    
Gene introns: 0  

>25222 239 1515     18q12.2    chr18:34731751-34731989 BLAT!
GCATTAAAGTGCGAGTGGTATGAGAAGGGCATCCATAGAAGAGGGCAGCTAGGCATAGAA
TATCAGAACTTTTGCACGGTGAGGAGGGCTTCCATATGGGAACTGCACTGGTGTTGTGTG
TTGGAGCTTGAGCAGAATGAGAAGGAGGTATCTATGTGGAGTTTGGCCTTGCAGGGGGTC
TTGTTACCCAGAGGGATGAAGAGAGCTTCCTTAGGAGTAGCCCAGTCATGGCTAGGGGG


invisible?    
Gene introns: KIAA1328 (34409079 - 34805288)  

>13763 236 1513     7q21.11    chr7:84335155-84334922 BLAT!
GGGTTTCACCATATTGGCCAGGCTGGTCTCAAACTCCTGGCGCCAAGTGATCCTCCCACT
TTGGTCTCTCAAAATGTTGGAATTACAGGGATGAGACACCATGTTTCATTCAAGTTTTAT
TCTCCAAATATTTGTCATTTATCAATCTTTTGCCTCTCAGATCTAAACCCACCCTTCATT
GCTTGCTCTATGAAAACACAGGTAATCCATTTAAACTTGTTTTTTTTTTTTTTTTT


invisible?    
Gene introns: 0  

>2919 188 1510     4q28.3    chr4:139422814-139423007 BLAT!
ACACACACACACAGACACACACACACACACACACACACACACAAAGAGACTTGAACAAAC
CCTAGCATAGTTTTTATTCGCTCAAGGCCATTTCCCTAGTATGACAATTGACAATTCCAG
CCCTCTTAAAATGCCTTCCTGAGACAGTTCAATGCTGCCAAAAGGCCATTTCCCTAGGAT
GACAATTC


invisible?    
Gene introns: 0  

>28944 190 1509     18q22.1    chr18:62185843-62186032 BLAT!
CCAGTGACTGAGTGCAGCACAGGGACTAAGGCAGGCTATTTCCTATAGGAAATAGGATTC
CTCTGGTGGAGACTTTGGCATGGGGACCCCCCATTAGTCTTGTCAAACTCTTAGAATCAC
ACTGCAGTCTAAGACCCTCCTTCCTTTCCTTCTCCTTCACAGGGGTCAGATATACACATT
AGGCTGATAG


invisible?    
Gene introns: 0  

>26761 246 1507     1q31.1    chr1:189961060-189960913 BLAT!
GAAGTTGGACTGGAAAATCTCCCAAACAATTTCTGATTGATTGGGTCAGGAAGAATCTTC
CCAAGAGTCCAAATCCTTCCTTTGAAAAAGTTCCAGTAGGTAGATACTGGAAATGTAGGG
TTAGGGTAATCAAGTCTGAAGATGATGTCCTGGTAGTATGCCCTACAATCTTAACAGAAG
ATGGCATGCAAGCTCAGCACCTGGGAGCTACTTTAGCCCTTTACCGTTTAGTTAAAGGGC
AGTCAG


invisible?    
Gene introns: 0  

>17232 207 1504     12p12.3    chr12:17838106-17837900 BLAT!
ATGCCATTGAATTATCACACAAAATATAAAATATCTATGAATCTATACTGATACAAATAA
ATAAATGGATAAATAAATGGAGAACAGACAACCCATCAAGATGAATTGCAAAAACTTTAT
GTTGATAATCCACTCTCACAGAGATTGAGCATAAATTCCCTGTCTTTAAGTATAGGCTGC
ACATTATTACTACTGAAGAATACATTA


invisible?    
Gene introns: 0  

>17344 211 1502     11q13.1    chr11:64903712-64903502 BLAT!
GAAATCATCAGCACCTGGGTCAGGGGCTGGACTGGAGCAGAGGAAATCATGCAGGAAAAG
TAAAGAGAAGGACATCAGGTAAAGAGAAGAGGACACATGCATAGCCAGAGAGAAAAGAGG
AGCAGAGGCATGTGGATCACAGAAGCTTAGGGAGGAGACTTTCAAGAAGGGGAGAGAGGT
TGAGTCACGCAAGGGCTGAAAGCCGACCATT


invisible?    
Gene introns: 0  

>28294 281 1501     4q26    chr4:117551597-117551437 BLAT!
TACAGGTGTATGCCACTACGCCTGGCTAATTTTCTGTATTTTTAGTAGAGACTGAGTTTC
ACCATGTTAGCCAGGTTGGTCTGGATCTCCTGGCCTCGTGATCCGCCTACCCTGGCCTCC
CAAAGTGCTGGGATTACAGGCATGAGACACCGTGCCCGGCCCAGAAAGTTAGTTTCTATT
CCCTCCCACTCCATAAACAACATACCTCATTTTATTGCACTTTGCAGATATACATTTTTT
ACAAATTGAAGGTTTGTGGCAACCTTGCATCCAGCAAGTCT


invisible?    
Gene introns: 0  

>1228 198 1500     1p34.3    chr1:34719195-34719392 BLAT!
GCATTCAAAGCAGTGTGTAGAGGGAAATTTATAGCACTAAATGCCCACAAGAGAAAGCAG
GAAAGATCCAAAATTGACACCCTAACATCACAATTAAAAGAACTAGAAAAGCAAGAGCAA
ACACATTCAAAAGCTAGCAGAAGGCAAGAAATAACTAAAATCAGAGCAGAACTGAAGGAA
ATAGAGACACAAAAAACC


invisible?    
Gene introns: 0  

>15689 272 1498     11p15.4    chr11:8204744-8204473 BLAT!
CATATACAAAAATTAACTCAAGATGGATTAAAGCCTTTAATGTAAAACCTAAAACGATAA
AAACCCTGGAAAGTAACCTATGAAATATCATTTTGGACATAGGACCTGGCAATGATTTCA
TGACAAAGATGCCAAAAACAATAGCAACAAAAACAAAAATTGGTAAATGGGACCTAATTA
AAGTAAAGAGCTTCTGCTGGCAAAAGAAATTATCAACAGAGTCAACGGACAATCTATAGA
ATGGGAGAAAATAATTGCAAAGTATGCATCAA


invisible?    
Gene introns: 0  

>1677 212 1494     1p33    chr1:47195913-47195702 BLAT!
TGAAGTTTAGTTTGGCTGGATATGGAATTTCTGAGTTGAAAATTCTTTTAAGAATATTGA
ATATTGGCCCCCACTCTCTTCTGGCCTGTAGGGTTTCTGCAGAGAGATCTGCTGTTAGTC
TGATGGGCTTCCCTTTGTGGGTAACCGGACCTTTCTCTCTGGCTGCGTTTAACATTTTTC
CTTCATTTCAACCTTGGTGAATCTGACGATTA


invisible?    
Gene introns: 0  

>17435 398 1493     2p22.3    chr2:34539953-34539557 BLAT!
TGGCTCCTCTTGAACACCAGAGGCACATGGCTAACTATTTTTTTCATTTTAACTGATCTC
TGGGTTATTGGCATTGATGCCAGTTTTCAAGAAGAAAAAATACAAGGAATAGGTTTGCAG
AAACCCTGACACCACCTTTACACCTGTAGGTTTTTTTCATGTTCAGCTTTCCTGATTAAA
ATAGAAGTGTTAAAATTGCATATTCAATGTTACTAAATAAATGTGGTAATTCTAAGCCTG
CACACACTTTGATTTTTAAAAGGAAAAATCATCAGATCACCTGAGGTCAGGAATTTGAGA
CCAGCTCTGCTCAACATGGCGAAACCCCATTTCTACTAAAAATACAAAGAATTAGCCAGG
CGTGTTGGCAGGCGCTTATAATCCCAGCTATTCGGGAG


invisible?    
Gene introns: 0  

>28395 210 1491     12q23.1    chr12:100193882-100193673 BLAT!
CAGTCACACTGGAGGTTAGGGCCTTAGCATGTGAGTTTTGGGGCACACAGATATTCAATC
CATAACATATTCCCTTCAGTCTATTTTCAGTCAAACAGCCAGAAGTGATCCCATTCAGTC
AGGTAATTTCATTTTCCTACTCAAAAACACTTCTATTGGTTTTCCATTTCACTCAGAGGA
AAAGCCAGAGTCCTTATAGTGTCTGATAGG


invisible?    
Gene introns: ANKS1B (99129070 - 100378432)  

>16794 282 1487     5q32    chr5:146907633-146907914 BLAT!
AAAGTTGAAGTGTTAAGTGCCATTCTGGGATGTAGATAGTAGAAAATGAATAGGCGGGAT
GAATGAGCTCTGACTCCTTTCAGTGTAGATGTCCCTTTTCCAAAGACTCAAATTCCAGGA
AGAGTGCATCTGATGGAGGCCTTGGATCACACGCTCACCTCCTAGGCAGAGAAGATCCTG
ATCAGTTGATTGATAGTTCTACAAGATTAGCCAAAGAGGGAGAAACTATGCAGCTAAATG
GGGATGGGGGAGGACTGTAACTAGGAGTCAAGGATTTGGGGC


invisible?    
Gene introns: 0  

>21654 288 1485     18q21.1    chr18:47022246-47022464 BLAT!
ACTATCAATATCTTCTTCATGGCTATACATGGTAACTAATGCAGATACCATGCCTGGTTT
ATGCTTTAACTCCTCTATGCTTCTCAATATTAGACATGCTTTAGAAATATTACCTTGAGA
AATTTTCAACTGTGCCATGGTCAGCTTAATTTCAGCTGCATTTTCTGGATGCTGATCTGA
AAATTCCTGAAGCAGCTCTATTGCTTTTGTGTGCTGCTTTTCACGGCAGAGCTGGGCAGC
TTGGATTAACACAGGCAAGAGATGCTCGGGACTTTGGGACTGTAAACT


invisible?    
Gene introns: 0  

>32346 286 1481     6p12.1    chr6:55545695-55545494 BLAT!
GTGGATGAAAAGGGGAAGATTGTGGATGCTAGGTTTAAAACATTTGGCTGTGGTTCCGCA
ATTGCCTCCAGCTCATTAGCCACTGAATGGGTGAAAGGAAAGACGGTGGAGGAAGCCTTG
ACTATCAAAAACACAGATATCGCCAAGGAGCTCTGCCTTCCTCCCGTGAAACTGCACTGC
TCCATGCTGGCTGAAGATGCAATCAAGGCCGCCCTGGCTGATTACAAATTGAAACAAGAA
CCCAAAAAAGGAGAGGCAGAGAAGAAATGAGCCCTCCCTCGGCGAA


invisible?    
Gene introns: 0  

>29362 223 1480     10q21.1    chr10:58031515-58031737 BLAT!
CCACATAAGTTTTCTGACACTGTCCAGTGCTATAGAATTAGATCATACATATATATATAG
TCTTTTTCTCAAAAATAATGGAGACAATTATCTTTCTTCTCACCTTGCCCTAACTGGACA
GCACTATTTCCCCTTTCTGTAAATCTATCACTAGCATTATGAGCTATTACTTTATCTTTC
TGAAACATGGCATATGCAATCTAAAAATCTCACAGAAAGGTCA


invisible?    
Gene introns: 0  

>32748 270 1479     Xq21.31    chrX:89242506-89242775 BLAT!
GAAGAGTGAGTAGGGCAAAGAATGTTATTGAGCCGACAGAAGGAAAGCTCTCACCGGAGA
AGGGACCCAAGAGCAGGTAGCACTCTGTGTGAGAGGGGACCTAAAAGTGAGTAGCCGTCT
GTGTGGCTGAGTCCAAGGTTTTCATGGGCTCAGAATAGCGGAGTGCATGTTGATGGCCCA
TGGGTGGGCCTGGAAAAAGCACCATTTGATTGGCTAAAAGGCATCAAGGAAGTTCTCACT
CCAGTCATGGACTCTTCCTGGAACTGGCAG


invisible?    
Gene introns: 0  

>1537 134 1478     19p13.3    chr19:249044-248911 BLAT!
TTTTTTTTTTCAAAATAATTAGCTTGGAATAATTCTTAAGCCAAAGGGACATATTTTGGG
GTTGCATATTCTGGTTTCCTACCATTATATTTTGGGGTGGCATATTTTGGTCTTATACAC
TGTGTTCCACCGGC


invisible?    
Gene introns: 0  

>15536 202 1477     10q22.2    chr10:76471532-76471331 BLAT!
ATAATTCTTTTTGTGTGTGTGACGTAAAACCTAAATATAATGAAATCACAACTTAAGTGG
GCTATTTCCTGAGCATTGACAAATGCATGTAACTGTGTAATCCTATTACGATGCGGCATA
TCATCATCAGTTCAGAAAGTCCCCTCACGACCCTTTCTAGTCAGTTTCCACTTTCCTCCT
CCCCTACAAAGGCAACCACTGC


invisible?    
Gene introns: 0  

>3385 243 1474     17q22    chr17:56359198-56359440 BLAT!
GAGGACCCTGGGGACTGTGGGCGCAGGACCAAGATAACTTCCTCTATCCCTCCTCACTCC
CCTTTCTTCTTGGCTTCTGGTAGAGGGCTGTCTCCAAACTCCTCCTCCCCACCACCATCT
GCTCCTGGATTTCAGGAACCAGGAGAGAGCAGAACTGGTTGTGGTTAGTGATCAGTTAGG
TGATGCAGCCCAGGGCCTCTCTGGGACAGGATCAGTGCAGTTGGGAGGACTTGGGTTAAT
GAT


invisible?    
Gene introns: 0  

>16370 219 1474     11p14.1    chr11:28617245-28617463 BLAT!
AGAGGGGAATATAAACTCTTTGTTCATTCTAATATCTTTAACCAGAATCTGACCTCTACA
TTTTACTTTCCTGTTATCCTCTAATAATAGTCCTATGAGGTAAGCAGGGCAGATATCATT
GTCCCTCTATTATTGATAAAATACTCACGATTCAGAGAGCTTAAAGGACTTGTTTGGAGT
TACTAAACAGGCTGAGAAATATTCAAGTCTCAGTAGCTA


invisible?    
Gene introns: 0  

>8735 231 1473     2p22.1    chr2:40136532-40136762 BLAT!
GCCTCCTGAGCCCTGCAGAACTGTGAGTCAATGAAACCTCTTTTCTTTATAAAAGTCTTG
GGCAGTTCTTTGCAGCAGTATGAAAATGGACTAATACATTAGTAAATGTGAATACCAGGA
GGCAGGGATTGTTGGGGGCTACTTTAGAAGGCTGCCTACCACAATAGCCATGTAACCTTG
AAAATTTGCTTAAGCTGTTTTGCTCGGTTTCCTTACCTGGGAAACAGGAAT


invisible?    
Gene introns: 0  

>9673 181 1463     6q14.1    chr6:77664323-77664143 BLAT!
ATGGTAATATAGCTGAAATGATTCTGAATCAAGCTGATTATGATAATAGTGATGATGAAG
ATGATGTTAATACTGCAGAAAAAGTGCCTATAAATGACACAGTGAAAACGTGTGGTTGAA
CAGCATGCATTTGTAACAACAAGAAATTATGTCAGTTTATACAATCAAAGAGAGACCACT
G


invisible?    
Gene introns: 0  

>8561 244 1460     12q21.2    chr12:77151038-77151281 BLAT!
TTCACAGTATTATCAGAAAATCCATCCAGCTTCACCATTACTGTGACGTCTGAGGCTGGA
GAAAATGATGAAACTGTCCAGACTACCCTCAAGTTTACATACAGTGAAAAATACCCAGAT
GAAGCTCCCCTTTATGAAATATTCTCCCAGGAAAATCTAGAAGATAATGATGTCTCAGAC
ATTTTAAAATTACTAGCATTACAGGCTGAAGAAAATCTTGGTATGGTGATGATTTTTACT
CTAG


invisible?    
Gene introns: 0  

>23227 136 1457     2q31.3    chr2:181673008-181673143 BLAT!
CACTAACATTCCACACAACAGTTGGATGCTCATTACCAGAGCATACCACATCTTCATTCA
AAACTCTACCATCATGAGCTCTGTCTGCCAAGGGCTGGGGAGAGAGGAATTTTCCCATTG
AGCTTCCATAACAGAA


invisible?    
Gene introns: 0  

>26718 442 1450     1q12    chr1:142542760-142542583 BLAT!
TCCACTCCATTCCACTCCATTCCACTCCACTCCATTCCACTAAATTTCATTCCATTCCAC
TGCACTCCTCTTCTCTCCACTCAACTCTACTCCACTCCACTCCACTCCATTCTGTTCCAA
TCCATTCCATTCCTTTCTGTTCCATTCCATTCCACTCCATTCCATTCCACTATAATCCAT
TTTACTCCATTACACTCTACTCCACTCAACTCCACTCCACTACACTCCTCTCTACTGCAT
TCCAGTCAACTCCACTCCATTCCATGCCACTCCATTCCATTCCACTCCACTCTGCTCCAT
TCCATTCCTTACCATTCCATTCCACTCCATTCCACTACACTCCTCTCCACTCCATTCCAT
TCCACTCCACTCCAATCCACTCCACTCCACTCCTCTAAACTCCATTCCATTCCAATCCAC
TCCACTCCCTTCCATTCCATTG


invisible?    
Gene introns: 0  

>20013 240 1448     10q23.1    chr10:86881210-86881449 BLAT!
TTTTGTTGGGGTCTACTTTTTCAATCTTACCCCATAACTTCCTTGCCCCACTAGGGCTGG
GACAAACCTCTCTAAGACCCAAATGTCCTTTTGTCCTTCTGCTAGGGAATTCTGGAAAAA
GTCAGATGCTTGCAGTGTCTAAGATCTCTTGTGACCCAGCTCATGCATACCATACTGGCC
CCTCTTCTTTTTGCTGGTCTTCACAATCCACGCTCCAGCTAGTGAGAAGCTGCCTCTGTT


invisible?    
Gene introns: 0  

>987 133 1446     Xq21.1    chrX:80185580-80185712 BLAT!
ACCAGAAAGTGAACAAGAAGTTGGAGACCGCTGTCAATCTTGCCTGGACAGCAGGAAACA
GTAACACGCGCTTCGGAATAGCAGCCAAGTATCAGATTGACCCTGACGCCTGCTTCTCGG
CTAAAGTGAACAA


invisible?    
Gene introns: 0  

Shown 481-510 from 3142 sequences on 17 of 105 pages.
Pages:  1  2  3  4  5  6  7  8  9  10  11  12  13  14  15  16  17  18  19  20  21  22  23  24  25  26  27  28  29  30  31  32  33  34  35  36  37  38  39  40  41  42  43  44  45  46  47  48  49  50  51  52  53  54  55  56  57  58  59  60  61  62  63  64  65  66  67  68  69  70  71  72  73  74  75  76  77  78  79  80  81  82  83  84  85  86  87  88  89  90  91  92  93  94  95  96  97  98  99  100  101  102  103  104  105

Databases: ABC2_contigs